Mutagenetix > Incidental Mutations

Incidental Mutation 'R2076:Ptprk'

229168

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

040081-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28589368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1349 (I1349K)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]

AlphaFold

P35822

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166468
AA Change: I1335K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I1335K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218276
AA Change: I1349K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218359
AA Change: I1323K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220357
AA Change: I270K

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220404

Meta Mutation Damage Score

0.3395

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,219,257	D1763E	possibly damaging	Het
Abca5	A	T	11: 110,287,652	V1165D	probably benign	Het
Acot11	T	C	4: 106,770,713	H103R	probably damaging	Het
AI481877	A	G	4: 59,082,410	V406A	possibly damaging	Het
Apba1	G	T	19: 23,893,223	E140*	probably null	Het
Bicdl1	A	T	5: 115,655,928	I253N	probably damaging	Het
Ccdc159	T	C	9: 21,929,506		probably null	Het
Ccne2	A	G	4: 11,197,177	R160G	probably damaging	Het
Cct7	A	T	6: 85,468,140	I458F	probably damaging	Het
Cd3g	T	A	9: 44,974,297	D50V	probably damaging	Het
Ces2h	T	C	8: 105,019,028	L461P	probably benign	Het
Csn2	A	G	5: 87,696,174	S19P	probably damaging	Het
Cyp3a11	A	T	5: 145,879,766	V4D	probably benign	Het
Ddx3y	A	G	Y: 1,266,593		probably null	Het
Dlgap1	C	T	17: 70,786,831	Q716*	probably null	Het
Dlx6	A	G	6: 6,867,098	S234G	probably benign	Het
Dnah7a	T	C	1: 53,503,809	T2401A	probably benign	Het
Dnah7b	T	G	1: 46,242,321	Y2847*	probably null	Het
Dpysl2	A	G	14: 66,865,122	S30P	probably damaging	Het
Ezh2	A	T	6: 47,576,633	L50*	probably null	Het
Fam135b	T	A	15: 71,478,243	E349D	probably damaging	Het
Fam69c	G	T	18: 84,736,908	D170Y	probably damaging	Het
Frat2	T	C	19: 41,847,803	T37A	probably benign	Het
Gm5294	A	G	5: 138,821,267	D100G	probably benign	Het
Hivep1	G	A	13: 42,164,393		probably null	Het
Hspb11	T	C	4: 107,279,767	S121P	possibly damaging	Het
Ikbkap	T	C	4: 56,786,620	D441G	probably damaging	Het
Impdh1	G	A	6: 29,205,163	A213V	probably damaging	Het
Irf2	G	T	8: 46,845,927	W252L	probably damaging	Het
Irx4	A	G	13: 73,268,265	D260G	probably damaging	Het
Kalrn	T	A	16: 34,332,143	H338L	probably benign	Het
Kif9	T	A	9: 110,485,032		probably null	Het
Klhl24	T	C	16: 20,117,878	V412A	probably damaging	Het
Lgals8	T	A	13: 12,454,869	K70*	probably null	Het
Mkl2	T	C	16: 13,401,382	S631P	probably benign	Het
Myo1e	T	A	9: 70,383,877	N983K	probably benign	Het
Nipbl	T	C	15: 8,311,207	R2010G	probably benign	Het
Npw	A	T	17: 24,657,439	V166D	possibly damaging	Het
Osbpl5	T	C	7: 143,709,144	Y169C	probably damaging	Het
Pcdh15	T	C	10: 74,342,647	Y579H	probably damaging	Het
Pde8a	A	G	7: 81,308,945	T330A	probably benign	Het
Plxnb2	C	T	15: 89,158,026	V1592M	probably damaging	Het
Ppp2r3a	A	C	9: 101,144,371	M955R	possibly damaging	Het
Rad52	C	T	6: 119,911,079	H9Y	probably benign	Het
Rapgef1	A	G	2: 29,702,508	Q466R	probably benign	Het
Rb1cc1	T	A	1: 6,250,038	I1227N	possibly damaging	Het
Rhbdf1	T	C	11: 32,214,088	M273V	probably benign	Het
Slc30a3	G	T	5: 31,086,821	Y323*	probably null	Het
Slc5a9	T	C	4: 111,885,573	I441V	possibly damaging	Het
Spast	G	C	17: 74,352,031	G131A	probably damaging	Het
Syne1	C	G	10: 5,040,897	W8444S	probably damaging	Het
Tgm4	G	T	9: 123,051,095	A211S	probably benign	Het
Themis2	T	C	4: 132,785,802	D371G	probably damaging	Het
Tmem132e	T	A	11: 82,435,068	I206N	possibly damaging	Het
Uba3	G	T	6: 97,199,280	D88E	probably damaging	Het
Vmn1r230	T	A	17: 20,846,882	M111K	probably damaging	Het
Wdr35	C	T	12: 9,024,281	H971Y	possibly damaging	Het
Yeats2	C	A	16: 20,186,282	H356Q	possibly damaging	Het
Zfp180	A	G	7: 24,105,103	K316E	probably damaging	Het
Zfp518a	T	C	19: 40,914,327	L900P	probably damaging	Het
Zfp655	A	G	5: 145,244,600	N423D	possibly damaging	Het
Zfp932	A	G	5: 110,009,468	Q344R	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCTAATTCCCTTCCCAGAG -3'
(R):5'- CTGGAACACATACTGTCCTGG -3'

Sequencing Primer
(F):5'- CAGTACTGGCCAGAAGAAG -3'
(R):5'- TACTGTCCTGGAACTAAGACATAAGG -3'

Posted On

2014-09-17