Incidental Mutation 'R2076:Fam135b'
ID229180
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2076 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71478243 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 349 (E349D)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably damaging
Transcript: ENSMUST00000022953
AA Change: E349D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: E349D

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
R8167:Fam135b UTSW 15 71532991 missense probably null 1.00
R8252:Fam135b UTSW 15 71533023 missense probably benign 0.10
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- TTGCCTGCACAGAACTGTAG -3'
(R):5'- GCTATAAAGACGTGTAAGCAGC -3'

Sequencing Primer
(F):5'- AGAGGGAAGCTAAGTGTCTGTTTCAC -3'
(R):5'- CTATAAAGACGTGTAAGCAGCAGAAG -3'
Posted On2014-09-17