Incidental Mutation 'R2076:Yeats2'
ID229184
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene NameYEATS domain containing 2
Synonyms
MMRRC Submission 040081-MU
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2076 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20141063-20232573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20186282 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 356 (H356Q)
Ref Sequence ENSEMBL: ENSMUSP00000155892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000232019] [ENSMUST00000232338]
Predicted Effect probably benign
Transcript: ENSMUST00000090052
AA Change: H340Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: H340Q

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115560
AA Change: H393Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: H393Q

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231861
Predicted Effect possibly damaging
Transcript: ENSMUST00000232019
AA Change: H356Q

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably benign
Transcript: ENSMUST00000232338
AA Change: H337Q

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0194:Yeats2 UTSW 16 20152969 start codon destroyed probably null 1.00
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4811:Yeats2 UTSW 16 20152895 splice site probably null
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5328:Yeats2 UTSW 16 20171205 missense probably damaging 1.00
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6168:Yeats2 UTSW 16 20179558 missense probably benign 0.01
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6371:Yeats2 UTSW 16 20221710 missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
R8353:Yeats2 UTSW 16 20222887 nonsense probably null
R8367:Yeats2 UTSW 16 20222825 missense probably damaging 1.00
R8453:Yeats2 UTSW 16 20222887 nonsense probably null
R8506:Yeats2 UTSW 16 20152934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGGTCTTAACTGTGCTCAC -3'
(R):5'- CTCATGGTGATTGGCTGAAAGG -3'

Sequencing Primer
(F):5'- TCACAGGTGTGTCTGCAC -3'
(R):5'- AAGGACTTGCCAGGTGACTC -3'
Posted On2014-09-17