Incidental Mutation 'R2076:Kalrn'
ID 229185
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 040081-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R2076 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 33969073-34573532 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34332143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 338 (H338L)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]
AlphaFold no structure available at present
PDB Structure Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: H338L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: H338L

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089655
AA Change: H356L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: H356L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114960
AA Change: H356L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: H356L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142817
AA Change: H333L
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: H333L

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151491
AA Change: H344L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: H344L

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Meta Mutation Damage Score 0.3977 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 (GRCm38) D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 (GRCm38) V1165D probably benign Het
Acot11 T C 4: 106,770,713 (GRCm38) H103R probably damaging Het
AI481877 A G 4: 59,082,410 (GRCm38) V406A possibly damaging Het
Apba1 G T 19: 23,893,223 (GRCm38) E140* probably null Het
Bicdl1 A T 5: 115,655,928 (GRCm38) I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 (GRCm38) probably null Het
Ccne2 A G 4: 11,197,177 (GRCm38) R160G probably damaging Het
Cct7 A T 6: 85,468,140 (GRCm38) I458F probably damaging Het
Cd3g T A 9: 44,974,297 (GRCm38) D50V probably damaging Het
Ces2h T C 8: 105,019,028 (GRCm38) L461P probably benign Het
Csn2 A G 5: 87,696,174 (GRCm38) S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 (GRCm38) V4D probably benign Het
Ddx3y A G Y: 1,266,593 (GRCm38) probably null Het
Dlgap1 C T 17: 70,786,831 (GRCm38) Q716* probably null Het
Dlx6 A G 6: 6,867,098 (GRCm38) S234G probably benign Het
Dnah7a T C 1: 53,503,809 (GRCm38) T2401A probably benign Het
Dnah7b T G 1: 46,242,321 (GRCm38) Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 (GRCm38) S30P probably damaging Het
Ezh2 A T 6: 47,576,633 (GRCm38) L50* probably null Het
Fam135b T A 15: 71,478,243 (GRCm38) E349D probably damaging Het
Fam69c G T 18: 84,736,908 (GRCm38) D170Y probably damaging Het
Frat2 T C 19: 41,847,803 (GRCm38) T37A probably benign Het
Gm5294 A G 5: 138,821,267 (GRCm38) D100G probably benign Het
Hivep1 G A 13: 42,164,393 (GRCm38) probably null Het
Hspb11 T C 4: 107,279,767 (GRCm38) S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 (GRCm38) D441G probably damaging Het
Impdh1 G A 6: 29,205,163 (GRCm38) A213V probably damaging Het
Irf2 G T 8: 46,845,927 (GRCm38) W252L probably damaging Het
Irx4 A G 13: 73,268,265 (GRCm38) D260G probably damaging Het
Kif9 T A 9: 110,485,032 (GRCm38) probably null Het
Klhl24 T C 16: 20,117,878 (GRCm38) V412A probably damaging Het
Lgals8 T A 13: 12,454,869 (GRCm38) K70* probably null Het
Mkl2 T C 16: 13,401,382 (GRCm38) S631P probably benign Het
Myo1e T A 9: 70,383,877 (GRCm38) N983K probably benign Het
Nipbl T C 15: 8,311,207 (GRCm38) R2010G probably benign Het
Npw A T 17: 24,657,439 (GRCm38) V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 (GRCm38) Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 (GRCm38) Y579H probably damaging Het
Pde8a A G 7: 81,308,945 (GRCm38) T330A probably benign Het
Plxnb2 C T 15: 89,158,026 (GRCm38) V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 (GRCm38) M955R possibly damaging Het
Ptprk T A 10: 28,589,368 (GRCm38) I1349K probably damaging Het
Rad52 C T 6: 119,911,079 (GRCm38) H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 (GRCm38) Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 (GRCm38) I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 (GRCm38) M273V probably benign Het
Slc30a3 G T 5: 31,086,821 (GRCm38) Y323* probably null Het
Slc5a9 T C 4: 111,885,573 (GRCm38) I441V possibly damaging Het
Spast G C 17: 74,352,031 (GRCm38) G131A probably damaging Het
Syne1 C G 10: 5,040,897 (GRCm38) W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 (GRCm38) A211S probably benign Het
Themis2 T C 4: 132,785,802 (GRCm38) D371G probably damaging Het
Tmem132e T A 11: 82,435,068 (GRCm38) I206N possibly damaging Het
Uba3 G T 6: 97,199,280 (GRCm38) D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 (GRCm38) M111K probably damaging Het
Wdr35 C T 12: 9,024,281 (GRCm38) H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 (GRCm38) H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 (GRCm38) K316E probably damaging Het
Zfp518a T C 19: 40,914,327 (GRCm38) L900P probably damaging Het
Zfp655 A G 5: 145,244,600 (GRCm38) N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 (GRCm38) Q344R probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34,175,722 (GRCm38) splice site probably benign
IGL01364:Kalrn APN 16 34,262,629 (GRCm38) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,235,330 (GRCm38) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,294,161 (GRCm38) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,198,512 (GRCm38) splice site probably null
IGL02059:Kalrn APN 16 34,252,341 (GRCm38) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,220,222 (GRCm38) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,310,527 (GRCm38) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,332,224 (GRCm38) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,360,846 (GRCm38) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,513,959 (GRCm38) nonsense probably null
IGL02696:Kalrn APN 16 34,220,114 (GRCm38) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,392,050 (GRCm38) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,220,130 (GRCm38) nonsense probably null
IGL03188:Kalrn APN 16 34,314,192 (GRCm38) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,385,297 (GRCm38) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,314,176 (GRCm38) missense probably damaging 0.99
breeze UTSW 16 34,013,675 (GRCm38) missense
ethereal UTSW 16 33,975,435 (GRCm38) utr 3 prime probably benign
Feather UTSW 16 34,314,209 (GRCm38) missense probably damaging 0.99
Hidden UTSW 16 34,027,976 (GRCm38) missense probably damaging 1.00
Soulful UTSW 16 34,187,484 (GRCm38) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,357,100 (GRCm38) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 34,031,582 (GRCm38) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,198,514 (GRCm38) splice site probably benign
R0043:Kalrn UTSW 16 34,054,906 (GRCm38) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,357,171 (GRCm38) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,203,957 (GRCm38) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,975,619 (GRCm38) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,975,619 (GRCm38) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34,031,590 (GRCm38) missense probably damaging 1.00
R0113:Kalrn UTSW 16 34,049,936 (GRCm38) intron probably benign
R0183:Kalrn UTSW 16 34,171,379 (GRCm38) splice site probably null
R0422:Kalrn UTSW 16 34,314,273 (GRCm38) missense probably damaging 0.99
R0498:Kalrn UTSW 16 34,054,891 (GRCm38) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,993,670 (GRCm38) splice site probably benign
R0656:Kalrn UTSW 16 34,032,467 (GRCm38) missense probably damaging 1.00
R0671:Kalrn UTSW 16 34,116,408 (GRCm38) missense probably benign 0.04
R0707:Kalrn UTSW 16 34,010,581 (GRCm38) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34,035,554 (GRCm38) missense probably damaging 1.00
R0834:Kalrn UTSW 16 34,049,919 (GRCm38) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,385,390 (GRCm38) missense probably damaging 1.00
R1297:Kalrn UTSW 16 34,016,498 (GRCm38) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,975,584 (GRCm38) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,975,584 (GRCm38) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,988,803 (GRCm38) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,212,820 (GRCm38) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,975,754 (GRCm38) missense probably damaging 1.00
R1458:Kalrn UTSW 16 34,174,487 (GRCm38) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,187,471 (GRCm38) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,187,471 (GRCm38) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,314,278 (GRCm38) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34,010,548 (GRCm38) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,975,738 (GRCm38) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,205,326 (GRCm38) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,360,950 (GRCm38) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,212,873 (GRCm38) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,294,215 (GRCm38) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,356,961 (GRCm38) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,975,923 (GRCm38) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,392,093 (GRCm38) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,392,093 (GRCm38) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,977,524 (GRCm38) critical splice donor site probably null
R1991:Kalrn UTSW 16 33,975,738 (GRCm38) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,975,738 (GRCm38) missense probably damaging 1.00
R2001:Kalrn UTSW 16 34,028,045 (GRCm38) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,189,736 (GRCm38) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,252,310 (GRCm38) missense probably benign 0.18
R2118:Kalrn UTSW 16 34,332,230 (GRCm38) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,307,724 (GRCm38) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34,009,262 (GRCm38) unclassified probably benign
R2193:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34,176,262 (GRCm38) splice site probably null
R2404:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,310,495 (GRCm38) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,212,272 (GRCm38) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,357,315 (GRCm38) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,392,030 (GRCm38) splice site probably null
R3788:Kalrn UTSW 16 34,220,240 (GRCm38) missense probably damaging 1.00
R3833:Kalrn UTSW 16 34,039,889 (GRCm38) nonsense probably null
R3871:Kalrn UTSW 16 34,203,856 (GRCm38) splice site probably null
R3934:Kalrn UTSW 16 34,310,531 (GRCm38) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,314,209 (GRCm38) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,314,209 (GRCm38) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,235,391 (GRCm38) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,987,208 (GRCm38) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,392,042 (GRCm38) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,235,267 (GRCm38) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,513,926 (GRCm38) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34,028,705 (GRCm38) missense probably damaging 0.99
R4651:Kalrn UTSW 16 34,176,391 (GRCm38) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,203,957 (GRCm38) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,203,957 (GRCm38) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,203,957 (GRCm38) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,198,487 (GRCm38) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,989,810 (GRCm38) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,356,969 (GRCm38) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,514,019 (GRCm38) unclassified probably benign
R4888:Kalrn UTSW 16 34,171,330 (GRCm38) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,357,415 (GRCm38) splice site probably null
R5030:Kalrn UTSW 16 33,975,742 (GRCm38) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,314,352 (GRCm38) nonsense probably null
R5117:Kalrn UTSW 16 34,033,601 (GRCm38) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,252,341 (GRCm38) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,262,653 (GRCm38) missense probably damaging 1.00
R5432:Kalrn UTSW 16 34,053,622 (GRCm38) missense probably damaging 1.00
R5611:Kalrn UTSW 16 34,175,780 (GRCm38) missense probably damaging 1.00
R5629:Kalrn UTSW 16 34,039,934 (GRCm38) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34,014,084 (GRCm38) missense probably damaging 1.00
R5713:Kalrn UTSW 16 34,016,579 (GRCm38) missense probably benign
R5716:Kalrn UTSW 16 33,987,176 (GRCm38) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,975,820 (GRCm38) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,212,249 (GRCm38) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,987,091 (GRCm38) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,975,435 (GRCm38) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,243,833 (GRCm38) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,357,343 (GRCm38) missense probably damaging 1.00
R6010:Kalrn UTSW 16 34,010,580 (GRCm38) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,360,885 (GRCm38) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,985,191 (GRCm38) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,212,885 (GRCm38) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,357,111 (GRCm38) missense probably damaging 1.00
R6178:Kalrn UTSW 16 34,053,639 (GRCm38) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34,055,071 (GRCm38) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,975,991 (GRCm38) missense probably benign
R6397:Kalrn UTSW 16 33,992,985 (GRCm38) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,332,164 (GRCm38) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,205,302 (GRCm38) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,360,984 (GRCm38) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,182,747 (GRCm38) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,217,923 (GRCm38) missense probably damaging 1.00
R6808:Kalrn UTSW 16 34,027,976 (GRCm38) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,975,703 (GRCm38) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,220,136 (GRCm38) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,357,048 (GRCm38) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,217,891 (GRCm38) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,256,227 (GRCm38) missense unknown
R7154:Kalrn UTSW 16 34,212,157 (GRCm38) critical splice donor site probably null
R7181:Kalrn UTSW 16 34,163,077 (GRCm38) missense probably benign 0.00
R7234:Kalrn UTSW 16 34,176,422 (GRCm38) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34,175,761 (GRCm38) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,256,233 (GRCm38) missense unknown
R7563:Kalrn UTSW 16 34,392,094 (GRCm38) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,314,212 (GRCm38) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34,031,582 (GRCm38) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,187,484 (GRCm38) nonsense probably null
R7867:Kalrn UTSW 16 33,989,791 (GRCm38) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,988,847 (GRCm38) missense probably damaging 0.98
R7914:Kalrn UTSW 16 34,028,752 (GRCm38) missense probably benign
R8080:Kalrn UTSW 16 33,975,668 (GRCm38) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 34,055,044 (GRCm38) missense probably benign
R8239:Kalrn UTSW 16 34,049,783 (GRCm38) missense noncoding transcript
R8281:Kalrn UTSW 16 34,035,061 (GRCm38) nonsense probably null
R8294:Kalrn UTSW 16 34,033,584 (GRCm38) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,357,100 (GRCm38) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,360,935 (GRCm38) missense probably damaging 1.00
R8693:Kalrn UTSW 16 34,034,514 (GRCm38) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,982,855 (GRCm38) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,205,326 (GRCm38) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,198,460 (GRCm38) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,217,935 (GRCm38) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,993,655 (GRCm38) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,227,126 (GRCm38) missense probably benign 0.22
R9048:Kalrn UTSW 16 34,034,484 (GRCm38) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,361,001 (GRCm38) missense probably damaging 0.96
R9317:Kalrn UTSW 16 34,013,675 (GRCm38) missense
R9424:Kalrn UTSW 16 33,988,818 (GRCm38) missense probably benign 0.06
R9442:Kalrn UTSW 16 34,095,879 (GRCm38) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,985,230 (GRCm38) missense probably benign 0.13
R9515:Kalrn UTSW 16 34,034,494 (GRCm38) missense probably damaging 1.00
R9516:Kalrn UTSW 16 34,034,494 (GRCm38) missense probably damaging 1.00
R9625:Kalrn UTSW 16 34,028,827 (GRCm38) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,212,213 (GRCm38) missense probably benign 0.01
RF014:Kalrn UTSW 16 34,039,933 (GRCm38) missense probably benign 0.01
Z1177:Kalrn UTSW 16 34,035,506 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGCACATTCCTTTCATAG -3'
(R):5'- GAATGCTTTGCCTGCTTGAC -3'

Sequencing Primer
(F):5'- CGTAGGAACAGCTGTTGGC -3'
(R):5'- GAATGCTTTGCCTGCTTGACCTATG -3'
Posted On 2014-09-17