Incidental Mutation 'R2076:Apba1'
ID 229193
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Name amyloid beta precursor protein binding family A member 1
Synonyms Lin-10, Mint1, X11, X11alpha, 6430513E09Rik, Mint
MMRRC Submission 040081-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2076 (G1)
Quality Score 123
Status Validated
Chromosome 19
Chromosomal Location 23736251-23926960 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 23870587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 140 (E140*)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
AlphaFold B2RUJ5
Predicted Effect probably null
Transcript: ENSMUST00000025830
AA Change: E140*
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: E140*

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,178,478 (GRCm39) V1165D probably benign Het
Acot11 T C 4: 106,627,910 (GRCm39) H103R probably damaging Het
Bicdl1 A T 5: 115,793,987 (GRCm39) I253N probably damaging Het
Ccdc159 T C 9: 21,840,802 (GRCm39) probably null Het
Ccne2 A G 4: 11,197,177 (GRCm39) R160G probably damaging Het
Cct7 A T 6: 85,445,122 (GRCm39) I458F probably damaging Het
Cd3g T A 9: 44,885,595 (GRCm39) D50V probably damaging Het
Ces2h T C 8: 105,745,660 (GRCm39) L461P probably benign Het
Cplane1 T A 15: 8,248,741 (GRCm39) D1763E possibly damaging Het
Csn2 A G 5: 87,844,033 (GRCm39) S19P probably damaging Het
Cyp3a11 A T 5: 145,816,576 (GRCm39) V4D probably benign Het
Ddx3y A G Y: 1,266,593 (GRCm39) probably null Het
Dipk1c G T 18: 84,755,033 (GRCm39) D170Y probably damaging Het
Dlgap1 C T 17: 71,093,826 (GRCm39) Q716* probably null Het
Dlx6 A G 6: 6,867,098 (GRCm39) S234G probably benign Het
Dnah7a T C 1: 53,542,968 (GRCm39) T2401A probably benign Het
Dnah7b T G 1: 46,281,481 (GRCm39) Y2847* probably null Het
Dpysl2 A G 14: 67,102,571 (GRCm39) S30P probably damaging Het
Elp1 T C 4: 56,786,620 (GRCm39) D441G probably damaging Het
Ezh2 A T 6: 47,553,567 (GRCm39) L50* probably null Het
Fam135b T A 15: 71,350,092 (GRCm39) E349D probably damaging Het
Foxl3 A G 5: 138,807,022 (GRCm39) D100G probably benign Het
Frat2 T C 19: 41,836,242 (GRCm39) T37A probably benign Het
Hivep1 G A 13: 42,317,869 (GRCm39) probably null Het
Ift25 T C 4: 107,136,964 (GRCm39) S121P possibly damaging Het
Impdh1 G A 6: 29,205,162 (GRCm39) A213V probably damaging Het
Irf2 G T 8: 47,298,962 (GRCm39) W252L probably damaging Het
Irx4 A G 13: 73,416,384 (GRCm39) D260G probably damaging Het
Kalrn T A 16: 34,152,513 (GRCm39) H338L probably benign Het
Kif9 T A 9: 110,314,100 (GRCm39) probably null Het
Klhl24 T C 16: 19,936,628 (GRCm39) V412A probably damaging Het
Lgals8 T A 13: 12,469,750 (GRCm39) K70* probably null Het
Mrtfb T C 16: 13,219,246 (GRCm39) S631P probably benign Het
Myo1e T A 9: 70,291,159 (GRCm39) N983K probably benign Het
Nipbl T C 15: 8,340,691 (GRCm39) R2010G probably benign Het
Npw A T 17: 24,876,413 (GRCm39) V166D possibly damaging Het
Osbpl5 T C 7: 143,262,881 (GRCm39) Y169C probably damaging Het
Pcdh15 T C 10: 74,178,479 (GRCm39) Y579H probably damaging Het
Pde8a A G 7: 80,958,693 (GRCm39) T330A probably benign Het
Plxnb2 C T 15: 89,042,229 (GRCm39) V1592M probably damaging Het
Ppp2r3d A C 9: 101,021,570 (GRCm39) M955R possibly damaging Het
Ptprk T A 10: 28,465,364 (GRCm39) I1349K probably damaging Het
Rad52 C T 6: 119,888,040 (GRCm39) H9Y probably benign Het
Rapgef1 A G 2: 29,592,520 (GRCm39) Q466R probably benign Het
Rb1cc1 T A 1: 6,320,262 (GRCm39) I1227N possibly damaging Het
Rhbdf1 T C 11: 32,164,088 (GRCm39) M273V probably benign Het
Shoc1 A G 4: 59,082,410 (GRCm39) V406A possibly damaging Het
Slc30a3 G T 5: 31,244,165 (GRCm39) Y323* probably null Het
Slc5a9 T C 4: 111,742,770 (GRCm39) I441V possibly damaging Het
Spast G C 17: 74,659,026 (GRCm39) G131A probably damaging Het
Syne1 C G 10: 4,990,897 (GRCm39) W8444S probably damaging Het
Tgm4 G T 9: 122,880,160 (GRCm39) A211S probably benign Het
Themis2 T C 4: 132,513,113 (GRCm39) D371G probably damaging Het
Tmem132e T A 11: 82,325,894 (GRCm39) I206N possibly damaging Het
Uba3 G T 6: 97,176,241 (GRCm39) D88E probably damaging Het
Vmn1r230 T A 17: 21,067,144 (GRCm39) M111K probably damaging Het
Wdr35 C T 12: 9,074,281 (GRCm39) H971Y possibly damaging Het
Yeats2 C A 16: 20,005,032 (GRCm39) H356Q possibly damaging Het
Zfp180 A G 7: 23,804,528 (GRCm39) K316E probably damaging Het
Zfp518a T C 19: 40,902,771 (GRCm39) L900P probably damaging Het
Zfp655 A G 5: 145,181,410 (GRCm39) N423D possibly damaging Het
Zfp932 A G 5: 110,157,334 (GRCm39) Q344R probably benign Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23,894,950 (GRCm39) missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23,914,836 (GRCm39) missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23,915,000 (GRCm39) splice site probably null
IGL02522:Apba1 APN 19 23,889,809 (GRCm39) splice site probably benign
IGL02728:Apba1 APN 19 23,922,269 (GRCm39) missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23,922,335 (GRCm39) missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23,894,939 (GRCm39) missense probably benign 0.02
IGL03410:Apba1 APN 19 23,914,945 (GRCm39) missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23,893,315 (GRCm39) missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23,893,315 (GRCm39) missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23,889,861 (GRCm39) missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23,912,194 (GRCm39) missense probably damaging 1.00
R0423:Apba1 UTSW 19 23,922,362 (GRCm39) missense probably damaging 1.00
R1132:Apba1 UTSW 19 23,894,917 (GRCm39) missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23,895,036 (GRCm39) missense probably damaging 0.97
R1681:Apba1 UTSW 19 23,913,925 (GRCm39) missense probably damaging 1.00
R1714:Apba1 UTSW 19 23,922,316 (GRCm39) missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23,871,056 (GRCm39) missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23,870,195 (GRCm39) missense probably benign 0.22
R2217:Apba1 UTSW 19 23,871,326 (GRCm39) missense probably damaging 0.99
R3907:Apba1 UTSW 19 23,914,870 (GRCm39) missense probably damaging 0.96
R4095:Apba1 UTSW 19 23,921,388 (GRCm39) missense probably benign 0.00
R4529:Apba1 UTSW 19 23,913,899 (GRCm39) missense probably damaging 1.00
R4557:Apba1 UTSW 19 23,894,956 (GRCm39) missense probably damaging 1.00
R4972:Apba1 UTSW 19 23,889,900 (GRCm39) missense probably benign 0.24
R5521:Apba1 UTSW 19 23,870,957 (GRCm39) missense probably damaging 1.00
R6539:Apba1 UTSW 19 23,913,924 (GRCm39) missense probably damaging 1.00
R7032:Apba1 UTSW 19 23,889,825 (GRCm39) missense probably benign 0.20
R7035:Apba1 UTSW 19 23,894,931 (GRCm39) missense possibly damaging 0.88
R7495:Apba1 UTSW 19 23,913,963 (GRCm39) critical splice donor site probably null
R9149:Apba1 UTSW 19 23,870,782 (GRCm39) missense probably damaging 1.00
R9288:Apba1 UTSW 19 23,923,145 (GRCm39) makesense probably null
Z1176:Apba1 UTSW 19 23,921,479 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAACCACTTGGAGGGC -3'
(R):5'- TCGTACACGTGCTCCTGGAG -3'

Sequencing Primer
(F):5'- GAGGGACAGCAGCCGTC -3'
(R):5'- TGGAGGCCGCCGTAGTC -3'
Posted On 2014-09-17