Incidental Mutation 'R2076:Apba1'
ID 229193
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Name amyloid beta (A4) precursor protein binding, family A, member 1
Synonyms 6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2076 (G1)
Quality Score 123
Status Validated
Chromosome 19
Chromosomal Location 23758876-23949597 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 23893223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 140 (E140*)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
AlphaFold B2RUJ5
Predicted Effect probably null
Transcript: ENSMUST00000025830
AA Change: E140*
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: E140*

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
R7495:Apba1 UTSW 19 23936599 critical splice donor site probably null
R9149:Apba1 UTSW 19 23893418 missense probably damaging 1.00
R9288:Apba1 UTSW 19 23945781 makesense probably null
Z1176:Apba1 UTSW 19 23944115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAACCACTTGGAGGGC -3'
(R):5'- TCGTACACGTGCTCCTGGAG -3'

Sequencing Primer
(F):5'- GAGGGACAGCAGCCGTC -3'
(R):5'- TGGAGGCCGCCGTAGTC -3'
Posted On 2014-09-17