Incidental Mutation 'R2077:Olfr1131'
ID229201
Institutional Source Beutler Lab
Gene Symbol Olfr1131
Ensembl Gene ENSMUSG00000068819
Gene Nameolfactory receptor 1131
SynonymsGA_x6K02T2Q125-49133664-49134593, MOR177-4
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87627104-87630203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87628829 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000150754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
Predicted Effect probably damaging
Transcript: ENSMUST00000090712
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: Y122C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213302
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably damaging
Transcript: ENSMUST00000216756
AA Change: Y6C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Olfr1131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr1131 APN 2 87628629 missense probably benign 0.03
IGL02186:Olfr1131 APN 2 87629371 missense probably benign 0.00
R0266:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R0849:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R1607:Olfr1131 UTSW 2 87628977 missense probably benign 0.14
R2105:Olfr1131 UTSW 2 87628939 missense probably benign 0.20
R2322:Olfr1131 UTSW 2 87628774 missense possibly damaging 0.86
R3434:Olfr1131 UTSW 2 87629074 missense probably benign 0.02
R4357:Olfr1131 UTSW 2 87628466 start codon destroyed probably null 1.00
R5139:Olfr1131 UTSW 2 87628656 missense probably benign 0.03
R5333:Olfr1131 UTSW 2 87629114 missense probably damaging 0.97
R5719:Olfr1131 UTSW 2 87629131 splice site probably null
R6449:Olfr1131 UTSW 2 87629149 missense possibly damaging 0.63
R7640:Olfr1131 UTSW 2 87629092 missense probably benign 0.01
R7941:Olfr1131 UTSW 2 87628904 missense probably benign 0.06
R8110:Olfr1131 UTSW 2 87628607 missense possibly damaging 0.75
R8393:Olfr1131 UTSW 2 87628853 missense probably damaging 0.97
R8877:Olfr1131 UTSW 2 87628868 missense probably damaging 1.00
X0027:Olfr1131 UTSW 2 87629303 missense possibly damaging 0.96
Z1176:Olfr1131 UTSW 2 87629315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCACCTGTCTTTCTGTG -3'
(R):5'- TGGTGCTCAGTTCAAGGAAG -3'

Sequencing Primer
(F):5'- GTGATCTTTGCTATTCCACAGC -3'
(R):5'- GTGCCAGGTAATTTACTTGAGTATC -3'
Posted On2014-09-17