Mutagenetix > Incidental Mutations

Incidental Mutation 'R2077:Kcnd3'

229204

Institutional Source

Beutler Lab

Gene Symbol

Kcnd3

Ensembl Gene

ENSMUSG00000040896

Gene Name

potassium voltage-gated channel, Shal-related family, member 3

Synonyms

Kv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L

MMRRC Submission

040082-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105452330-105674002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105666999 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 500 (V500A)

Ref Sequence

ENSEMBL: ENSMUSP00000113436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]

Predicted Effect

probably benign
Transcript: ENSMUST00000079169
AA Change: V500A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: V500A

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098761

SMART Domains

Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	7.3e-19	PFAM
BTB	40	139	1.76e-16	SMART
transmembrane domain	180	202	N/A	INTRINSIC
Pfam:Ion_trans	228	402	1e-31	PFAM
Pfam:Ion_trans_2	327	408	8.4e-15	PFAM
low complexity region	412	431	N/A	INTRINSIC
Pfam:DUF3399	442	545	9.5e-52	PFAM
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118360
AA Change: V500A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: V500A

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141694

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147209

Meta Mutation Damage Score

0.0833

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	A	4: 144,457,034		probably benign	Het
Abhd16b	A	C	2: 181,493,416	D37A	probably benign	Het
Acp7	T	C	7: 28,629,482	E91G	probably damaging	Het
Alms1	T	A	6: 85,622,309	N1841K	possibly damaging	Het
Arhgap25	T	A	6: 87,460,008	D620V	probably damaging	Het
Caps2	C	T	10: 112,199,727	T371I	possibly damaging	Het
Ccdc175	A	G	12: 72,140,020	I350T	possibly damaging	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Cdc42bpb	A	G	12: 111,299,196	L1434P	probably damaging	Het
Cdkl3	A	T	11: 52,026,839	E321V	probably damaging	Het
Clec2d	G	T	6: 129,183,190	V56L	possibly damaging	Het
Cops3	A	T	11: 59,824,310	S301T	possibly damaging	Het
Crygd	T	C	1: 65,063,246	D19G	probably damaging	Het
Dnah2	T	C	11: 69,496,606	I931M	possibly damaging	Het
Dst	A	T	1: 34,211,170	R4068S	probably damaging	Het
Fas	C	T	19: 34,320,553		probably benign	Het
G6pd2	T	A	5: 61,810,251	D456E	probably damaging	Het
Galnt18	G	A	7: 111,554,602	R272W	probably damaging	Het
Grb2	C	A	11: 115,645,825	G200W	probably damaging	Het
Herc4	A	G	10: 63,264,053	N85S	probably benign	Het
Ighv7-2	T	C	12: 113,912,107	D92G	probably damaging	Het
Itih3	A	G	14: 30,909,835	V765A	possibly damaging	Het
Itm2b	T	C	14: 73,363,120	N247D	probably benign	Het
Lrp2	C	T	2: 69,507,843	G1198R	probably damaging	Het
Ltb4r2	A	G	14: 55,761,987	T22A	probably damaging	Het
Mdga2	A	G	12: 66,655,362	V355A	probably damaging	Het
Megf8	T	A	7: 25,353,738	V1778E	probably benign	Het
Mroh2b	G	A	15: 4,944,966	E1143K	probably damaging	Het
Nbn	A	T	4: 15,979,389	Y458F	probably damaging	Het
Nlrc3	A	G	16: 3,963,992	C534R	probably benign	Het
Nup155	A	G	15: 8,143,026	E832G	probably damaging	Het
Olfr1131	A	G	2: 87,628,829	Y122C	probably damaging	Het
Plcl2	A	G	17: 50,606,829	T289A	probably benign	Het
Ptprs	C	T	17: 56,434,990	R7Q	probably null	Het
Rab3ip	A	T	10: 116,918,960	D198E	possibly damaging	Het
Scaf4	A	T	16: 90,252,435	F255I	unknown	Het
Senp6	T	C	9: 80,126,155	S475P	probably benign	Het
Shpk	T	C	11: 73,203,959	L67P	probably damaging	Het
Sik3	T	A	9: 46,219,503	Y1246N	probably damaging	Het
Slc44a2	A	G	9: 21,353,724	Y686C	probably damaging	Het
Slc6a19	A	G	13: 73,700,566	V23A	probably benign	Het
Slit3	A	T	11: 35,544,748	I169F	possibly damaging	Het
Stxbp5l	A	G	16: 37,236,275	V379A	possibly damaging	Het
Tex2	T	C	11: 106,506,864		probably null	Het
Tnpo3	A	G	6: 29,586,144	V149A	possibly damaging	Het
Vmn1r158	T	A	7: 22,790,390	R131S	probably benign	Het
Vmn2r24	T	A	6: 123,815,399	C562S	probably damaging	Het
Wipi1	T	C	11: 109,577,664	N368S	probably benign	Het
Zbtb41	T	C	1: 139,424,093	S315P	probably damaging	Het

Other mutations in Kcnd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02296:Kcnd3	APN	3	105667001	nonsense	probably null
PIT4498001:Kcnd3	UTSW	3	105658709	missense	probably damaging	0.99
R0483:Kcnd3	UTSW	3	105459626	missense	probably damaging	1.00
R0544:Kcnd3	UTSW	3	105658759	missense	probably damaging	1.00
R1457:Kcnd3	UTSW	3	105668186	missense	probably benign	0.00
R1853:Kcnd3	UTSW	3	105459752	missense	probably damaging	1.00
R2030:Kcnd3	UTSW	3	105459537	missense	probably damaging	1.00
R2106:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2287:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2288:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2316:Kcnd3	UTSW	3	105669126	missense	probably benign	0.17
R2909:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2924:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R2925:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3014:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3016:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3038:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3696:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3697:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3698:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3777:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3778:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3785:Kcnd3	UTSW	3	105668225	missense	possibly damaging	0.79
R3810:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3811:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3815:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3816:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3819:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3877:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3879:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R3899:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4300:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4367:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4370:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4491:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4549:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4550:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4569:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4571:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4593:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4594:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4595:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4624:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4625:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4627:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4630:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4631:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4632:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4799:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R4822:Kcnd3	UTSW	3	105658766	missense	probably damaging	1.00
R5021:Kcnd3	UTSW	3	105658754	missense	probably damaging	1.00
R5056:Kcnd3	UTSW	3	105666928	intron	probably benign
R5849:Kcnd3	UTSW	3	105458795	utr 5 prime	probably benign
R7198:Kcnd3	UTSW	3	105459540	missense	probably damaging	1.00
R7224:Kcnd3	UTSW	3	105669084	missense	probably damaging	0.98
R7532:Kcnd3	UTSW	3	105668210	missense	probably damaging	1.00
R7578:Kcnd3	UTSW	3	105459617	missense	probably benign	0.08
R7975:Kcnd3	UTSW	3	105458994	missense	probably damaging	1.00
R8022:Kcnd3	UTSW	3	105458873	missense	probably benign	0.19
R8823:Kcnd3	UTSW	3	105667014	missense	probably benign	0.00
Z1177:Kcnd3	UTSW	3	105459570	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCTATTGGAACCAAGGGG -3'
(R):5'- AAACCACTAGGAGCCTGAGC -3'

Sequencing Primer
(F):5'- CCAAGGGGTGAAATGTTGGGAC -3'
(R):5'- CTGGTACTGGGTGTGACAACAG -3'

Posted On

2014-09-17