Incidental Mutation 'R2077:G6pd2'
ID229207
Institutional Source Beutler Lab
Gene Symbol G6pd2
Ensembl Gene ENSMUSG00000089992
Gene Nameglucose-6-phosphate dehydrogenase 2
SynonymsGpd2, Gpd-2, G6pdx-ps1
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location61808816-61811163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61810251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 456 (D456E)
Ref Sequence ENSEMBL: ENSMUSP00000131163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053876]
Predicted Effect probably damaging
Transcript: ENSMUST00000053876
AA Change: D456E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131163
Gene: ENSMUSG00000089992
AA Change: D456E

DomainStartEndE-ValueType
Pfam:G6PD_N 35 210 4.1e-60 PFAM
Pfam:G6PD_C 212 504 9.9e-119 PFAM
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in G6pd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:G6pd2 APN 5 61810063 missense probably benign
IGL01329:G6pd2 APN 5 61809938 missense probably damaging 1.00
IGL02072:G6pd2 APN 5 61809410 missense probably damaging 1.00
IGL02502:G6pd2 APN 5 61809628 missense probably damaging 1.00
IGL02800:G6pd2 APN 5 61809392 missense probably damaging 1.00
IGL03012:G6pd2 APN 5 61809473 missense probably damaging 1.00
IGL03085:G6pd2 APN 5 61810302 missense probably benign
R0505:G6pd2 UTSW 5 61809567 missense probably benign
R0632:G6pd2 UTSW 5 61810171 missense probably benign
R0658:G6pd2 UTSW 5 61809674 missense probably damaging 1.00
R1399:G6pd2 UTSW 5 61810018 missense probably benign 0.02
R1918:G6pd2 UTSW 5 61810321 missense probably benign
R2338:G6pd2 UTSW 5 61810008 missense probably benign
R2566:G6pd2 UTSW 5 61808987 missense probably damaging 1.00
R2918:G6pd2 UTSW 5 61809526 missense probably damaging 1.00
R3963:G6pd2 UTSW 5 61808885 start codon destroyed probably null 0.50
R4399:G6pd2 UTSW 5 61810173 missense probably benign 0.01
R4469:G6pd2 UTSW 5 61808945 missense probably benign
R4560:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4563:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4914:G6pd2 UTSW 5 61810329 nonsense probably null
R5106:G6pd2 UTSW 5 61810352 missense probably benign
R5242:G6pd2 UTSW 5 61809442 missense probably benign 0.00
R5838:G6pd2 UTSW 5 61809225 missense probably benign
R6131:G6pd2 UTSW 5 61809250 missense probably benign 0.03
R6200:G6pd2 UTSW 5 61809871 missense probably benign 0.00
R7009:G6pd2 UTSW 5 61808891 missense probably benign 0.00
R7337:G6pd2 UTSW 5 61810219 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCCACCAGAAGTGCAAGC -3'
(R):5'- TCAGTGCTTGTGAGTACCCTTG -3'

Sequencing Primer
(F):5'- CAAGCGTAATGAGCTGGTCATCC -3'
(R):5'- GTAGGTACCCTTGTACTGGAAGCC -3'
Posted On2014-09-17