Mutagenetix > Incidental Mutations

Incidental Mutation 'R2077:Vmn2r24'

229211

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r24

Ensembl Gene

ENSMUSG00000072780

Gene Name

vomeronasal 2, receptor 24

Synonyms

EG243628

MMRRC Submission

040082-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R2077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123778971-123816280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123815399 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 562 (C562S)

Ref Sequence

ENSEMBL: ENSMUSP00000074602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075095]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075095
AA Change: C562S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: C562S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	1.6e-32	PFAM
Pfam:NCD3G	518	571	1.1e-22	PFAM
Pfam:7tm_3	602	839	1.1e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	A	4: 144,457,034		probably benign	Het
Abhd16b	A	C	2: 181,493,416	D37A	probably benign	Het
Acp7	T	C	7: 28,629,482	E91G	probably damaging	Het
Alms1	T	A	6: 85,622,309	N1841K	possibly damaging	Het
Arhgap25	T	A	6: 87,460,008	D620V	probably damaging	Het
Caps2	C	T	10: 112,199,727	T371I	possibly damaging	Het
Ccdc175	A	G	12: 72,140,020	I350T	possibly damaging	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Cdc42bpb	A	G	12: 111,299,196	L1434P	probably damaging	Het
Cdkl3	A	T	11: 52,026,839	E321V	probably damaging	Het
Clec2d	G	T	6: 129,183,190	V56L	possibly damaging	Het
Cops3	A	T	11: 59,824,310	S301T	possibly damaging	Het
Crygd	T	C	1: 65,063,246	D19G	probably damaging	Het
Dnah2	T	C	11: 69,496,606	I931M	possibly damaging	Het
Dst	A	T	1: 34,211,170	R4068S	probably damaging	Het
Fas	C	T	19: 34,320,553		probably benign	Het
G6pd2	T	A	5: 61,810,251	D456E	probably damaging	Het
Galnt18	G	A	7: 111,554,602	R272W	probably damaging	Het
Grb2	C	A	11: 115,645,825	G200W	probably damaging	Het
Herc4	A	G	10: 63,264,053	N85S	probably benign	Het
Ighv7-2	T	C	12: 113,912,107	D92G	probably damaging	Het
Itih3	A	G	14: 30,909,835	V765A	possibly damaging	Het
Itm2b	T	C	14: 73,363,120	N247D	probably benign	Het
Kcnd3	T	C	3: 105,666,999	V500A	probably benign	Het
Lrp2	C	T	2: 69,507,843	G1198R	probably damaging	Het
Ltb4r2	A	G	14: 55,761,987	T22A	probably damaging	Het
Mdga2	A	G	12: 66,655,362	V355A	probably damaging	Het
Megf8	T	A	7: 25,353,738	V1778E	probably benign	Het
Mroh2b	G	A	15: 4,944,966	E1143K	probably damaging	Het
Nbn	A	T	4: 15,979,389	Y458F	probably damaging	Het
Nlrc3	A	G	16: 3,963,992	C534R	probably benign	Het
Nup155	A	G	15: 8,143,026	E832G	probably damaging	Het
Olfr1131	A	G	2: 87,628,829	Y122C	probably damaging	Het
Plcl2	A	G	17: 50,606,829	T289A	probably benign	Het
Ptprs	C	T	17: 56,434,990	R7Q	probably null	Het
Rab3ip	A	T	10: 116,918,960	D198E	possibly damaging	Het
Scaf4	A	T	16: 90,252,435	F255I	unknown	Het
Senp6	T	C	9: 80,126,155	S475P	probably benign	Het
Shpk	T	C	11: 73,203,959	L67P	probably damaging	Het
Sik3	T	A	9: 46,219,503	Y1246N	probably damaging	Het
Slc44a2	A	G	9: 21,353,724	Y686C	probably damaging	Het
Slc6a19	A	G	13: 73,700,566	V23A	probably benign	Het
Slit3	A	T	11: 35,544,748	I169F	possibly damaging	Het
Stxbp5l	A	G	16: 37,236,275	V379A	possibly damaging	Het
Tex2	T	C	11: 106,506,864		probably null	Het
Tnpo3	A	G	6: 29,586,144	V149A	possibly damaging	Het
Vmn1r158	T	A	7: 22,790,390	R131S	probably benign	Het
Wipi1	T	C	11: 109,577,664	N368S	probably benign	Het
Zbtb41	T	C	1: 139,424,093	S315P	probably damaging	Het

Other mutations in Vmn2r24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Vmn2r24	APN	6	123815637	missense	probably damaging	1.00
IGL01382:Vmn2r24	APN	6	123786979	missense	possibly damaging	0.62
IGL01592:Vmn2r24	APN	6	123787486	missense	probably benign	0.30
IGL01754:Vmn2r24	APN	6	123804161	missense	probably damaging	1.00
IGL01939:Vmn2r24	APN	6	123787445	missense	probably benign
IGL02140:Vmn2r24	APN	6	123780672	missense	probably damaging	0.98
IGL02272:Vmn2r24	APN	6	123786884	missense	possibly damaging	0.94
IGL02568:Vmn2r24	APN	6	123815853	missense	probably benign	0.36
IGL02748:Vmn2r24	APN	6	123816098	missense	possibly damaging	0.90
IGL03022:Vmn2r24	APN	6	123779008	missense	probably damaging	0.99
IGL03343:Vmn2r24	APN	6	123816111	missense	probably damaging	1.00
R0357:Vmn2r24	UTSW	6	123815410	frame shift	probably null
R0453:Vmn2r24	UTSW	6	123780391	critical splice acceptor site	probably null
R0538:Vmn2r24	UTSW	6	123816053	missense	probably benign	0.32
R0607:Vmn2r24	UTSW	6	123786934	missense	probably benign
R1381:Vmn2r24	UTSW	6	123786733	missense	probably damaging	1.00
R1589:Vmn2r24	UTSW	6	123806520	splice site	probably benign
R1848:Vmn2r24	UTSW	6	123816224	missense	probably damaging	1.00
R2035:Vmn2r24	UTSW	6	123816060	missense	probably damaging	1.00
R2122:Vmn2r24	UTSW	6	123815394	missense	possibly damaging	0.81
R2145:Vmn2r24	UTSW	6	123779013	missense	probably benign
R2483:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R2512:Vmn2r24	UTSW	6	123787026	missense	probably benign	0.01
R3001:Vmn2r24	UTSW	6	123804272	missense	probably benign	0.00
R3002:Vmn2r24	UTSW	6	123804272	missense	probably benign	0.00
R3236:Vmn2r24	UTSW	6	123779025	nonsense	probably null
R3623:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R3624:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R3835:Vmn2r24	UTSW	6	123787453	missense	probably benign	0.33
R4074:Vmn2r24	UTSW	6	123787415	missense	possibly damaging	0.92
R4075:Vmn2r24	UTSW	6	123787415	missense	possibly damaging	0.92
R4812:Vmn2r24	UTSW	6	123779185	missense	probably benign	0.00
R4825:Vmn2r24	UTSW	6	123815780	missense	probably benign	0.02
R5351:Vmn2r24	UTSW	6	123816264	missense	possibly damaging	0.80
R5665:Vmn2r24	UTSW	6	123786979	missense	possibly damaging	0.62
R5790:Vmn2r24	UTSW	6	123815540	missense	probably benign
R5808:Vmn2r24	UTSW	6	123815638	nonsense	probably null
R5879:Vmn2r24	UTSW	6	123787267	missense	possibly damaging	0.89
R5923:Vmn2r24	UTSW	6	123815792	missense	probably damaging	0.96
R5969:Vmn2r24	UTSW	6	123779022	missense	probably benign	0.00
R6050:Vmn2r24	UTSW	6	123815732	missense	probably damaging	1.00
R6171:Vmn2r24	UTSW	6	123787246	missense	probably damaging	0.98
R6174:Vmn2r24	UTSW	6	123816277	missense	probably benign	0.00
R6356:Vmn2r24	UTSW	6	123806409	missense	possibly damaging	0.93
R6562:Vmn2r24	UTSW	6	123780427	missense	probably benign	0.01
R6563:Vmn2r24	UTSW	6	123804178	missense	possibly damaging	0.86
R6584:Vmn2r24	UTSW	6	123815805	missense	possibly damaging	0.53
R6630:Vmn2r24	UTSW	6	123787022	missense	probably benign	0.00
R6803:Vmn2r24	UTSW	6	123779001	missense	possibly damaging	0.64
R6864:Vmn2r24	UTSW	6	123779158	missense	possibly damaging	0.89
R7252:Vmn2r24	UTSW	6	123787232	missense	possibly damaging	0.90
R7369:Vmn2r24	UTSW	6	123815679	missense	probably damaging	0.99
R7646:Vmn2r24	UTSW	6	123816210	missense	probably benign	0.20
R7799:Vmn2r24	UTSW	6	123780463	missense	probably benign	0.00
R7803:Vmn2r24	UTSW	6	123780479	missense	probably benign	0.00
RF006:Vmn2r24	UTSW	6	123806419	missense	probably damaging	1.00
RF016:Vmn2r24	UTSW	6	123804215	missense	probably benign	0.04
X0023:Vmn2r24	UTSW	6	123787400	missense	probably damaging	0.99
Z1088:Vmn2r24	UTSW	6	123804196	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCACTCACTTCTGAACATATTATGG -3'
(R):5'- GTGTCCCGATAGCAGACAAATAATCC -3'

Sequencing Primer
(F):5'- ACTTCTGAACATATTATGGAAAAGGG -3'
(R):5'- TCCTAAAATCATGGCTGAAAAGGC -3'

Posted On

2014-09-17