Incidental Mutation 'R2077:Acp7'
ID229215
Institutional Source Beutler Lab
Gene Symbol Acp7
Ensembl Gene ENSMUSG00000037469
Gene Nameacid phosphatase 7, tartrate resistant
SynonymsPapl, C330005M16Rik
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28607634-28631332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28629482 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 91 (E91G)
Ref Sequence ENSEMBL: ENSMUSP00000045437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040112] [ENSMUST00000159095] [ENSMUST00000159418] [ENSMUST00000159560] [ENSMUST00000162880]
Predicted Effect probably damaging
Transcript: ENSMUST00000040112
AA Change: E91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469
AA Change: E91G

DomainStartEndE-ValueType
Pfam:Pur_ac_phosph_N 90 183 2.2e-19 PFAM
Pfam:Metallophos 192 395 6.4e-27 PFAM
Pfam:Metallophos_C 420 482 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159095
Predicted Effect probably damaging
Transcript: ENSMUST00000159418
AA Change: E33G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000159560
AA Change: E33G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000162880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208431
Meta Mutation Damage Score 0.1826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Acp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acp7 APN 7 28614697 missense possibly damaging 0.79
IGL00808:Acp7 APN 7 28614952 missense probably damaging 1.00
IGL01085:Acp7 APN 7 28611053 missense probably damaging 1.00
IGL02123:Acp7 APN 7 28629489 missense probably benign
IGL02250:Acp7 APN 7 28629710 splice site probably benign
IGL02255:Acp7 APN 7 28614723 missense probably damaging 1.00
IGL02904:Acp7 APN 7 28608003 missense probably benign 0.11
IGL03110:Acp7 APN 7 28611039 missense probably benign 0.25
R0172:Acp7 UTSW 7 28615124 missense possibly damaging 0.95
R0360:Acp7 UTSW 7 28611128 splice site probably benign
R0364:Acp7 UTSW 7 28611128 splice site probably benign
R1616:Acp7 UTSW 7 28611078 missense probably damaging 1.00
R1973:Acp7 UTSW 7 28607989 missense probably damaging 1.00
R2125:Acp7 UTSW 7 28629549 missense probably damaging 0.99
R2256:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2257:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2696:Acp7 UTSW 7 28614576 missense probably benign 0.00
R3103:Acp7 UTSW 7 28610984 critical splice donor site probably null
R3753:Acp7 UTSW 7 28616660 missense probably damaging 1.00
R3833:Acp7 UTSW 7 28615094 missense probably benign 0.00
R4622:Acp7 UTSW 7 28614397 missense probably damaging 1.00
R4849:Acp7 UTSW 7 28615452 missense possibly damaging 0.82
R5364:Acp7 UTSW 7 28611023 missense probably benign 0.25
R5382:Acp7 UTSW 7 28615419 missense possibly damaging 0.80
R5665:Acp7 UTSW 7 28616543 missense probably benign 0.31
R5688:Acp7 UTSW 7 28616495 missense probably benign 0.20
R7278:Acp7 UTSW 7 28630882 missense unknown
R7295:Acp7 UTSW 7 28629530 missense possibly damaging 0.83
R7384:Acp7 UTSW 7 28615088 missense possibly damaging 0.89
R7875:Acp7 UTSW 7 28614727 missense probably damaging 1.00
R8227:Acp7 UTSW 7 28616648 missense probably damaging 1.00
R8772:Acp7 UTSW 7 28616484 missense probably damaging 0.99
RF006:Acp7 UTSW 7 28614779 missense possibly damaging 0.94
X0018:Acp7 UTSW 7 28607981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCTGAAATCCCATTTC -3'
(R):5'- ACAGACATCCTGACAGACGG -3'

Sequencing Primer
(F):5'- GAAATCCCATTTCACAGAGGC -3'
(R):5'- CTGACAGACGGACACACGG -3'
Posted On2014-09-17