Incidental Mutation 'R2077:Cdkl3'
ID229225
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52026839 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 321 (E321V)
Ref Sequence ENSEMBL: ENSMUSP00000123279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000128853] [ENSMUST00000143228]
Predicted Effect probably damaging
Transcript: ENSMUST00000063303
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000063321
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109076
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109077
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109078
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109079
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000109080
AA Change: E321V

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109081
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120374
AA Change: E321V

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121591
AA Change: E321V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128853
SMART Domains Protein: ENSMUSP00000121945
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 1 110 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000143228
AA Change: E321V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389
AA Change: E321V

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147874
SMART Domains Protein: ENSMUSP00000119505
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 2 36 5e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R0848:Cdkl3 UTSW 11 52011267 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 52032510 missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 52025869 missense probably benign 0.04
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7068:Cdkl3 UTSW 11 52011327 critical splice donor site probably null
R7406:Cdkl3 UTSW 11 52033542 missense probably benign 0.11
R7658:Cdkl3 UTSW 11 52027182 missense not run
R7870:Cdkl3 UTSW 11 52018457 critical splice donor site probably null
R8324:Cdkl3 UTSW 11 52022879 critical splice donor site probably null
R8331:Cdkl3 UTSW 11 52026877 missense probably benign 0.04
R8349:Cdkl3 UTSW 11 52084433 missense
R8449:Cdkl3 UTSW 11 52084433 missense
R8806:Cdkl3 UTSW 11 52032468 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGGCACCAGTTACTATTATACAGC -3'
(R):5'- CTGACTTTGAGCTCCTTGGC -3'

Sequencing Primer
(F):5'- CATCTTAATGCTTGATTGAATGCTTC -3'
(R):5'- TCTGTCCACTTCCTAGAAGAGG -3'
Posted On2014-09-17