Mutagenetix > Incidental Mutations

Incidental Mutation 'R2077:Cops3'

229226

Institutional Source

Beutler Lab

Gene Symbol

Cops3

Ensembl Gene

ENSMUSG00000019373

Gene Name

COP9 signalosome subunit 3

Synonyms

Csn3, Sgn3, COP9 complex S3

MMRRC Submission

040082-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59817795-59839838 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59824310 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 301 (S301T)

Ref Sequence

ENSEMBL: ENSMUSP00000019517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019517]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019517
AA Change: S301T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000019517
Gene: ENSMUSG00000019373
AA Change: S301T

Domain	Start	End	E-Value	Type
PINT	293	383	1.16e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124101

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136901

Predicted Effect

probably benign
Transcript: ENSMUST00000156837
AA Change: S223T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000117288
Gene: ENSMUSG00000019373
AA Change: S223T

Domain	Start	End	E-Value	Type
SCOP:d1ihga1	55	132	6e-4	SMART
Blast:PINT	216	244	4e-10	BLAST

Meta Mutation Damage Score

0.4837

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene possesses kinase activity that phosphorylates regulators involved in signal transduction. It phosphorylates I kappa-Balpha, p105, and c-Jun. It acts as a docking site for complex-mediated phosphorylation. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with defects in developmental patterning and failure of the inner cell mass to proliferate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	A	4: 144,457,034		probably benign	Het
Abhd16b	A	C	2: 181,493,416	D37A	probably benign	Het
Acp7	T	C	7: 28,629,482	E91G	probably damaging	Het
Alms1	T	A	6: 85,622,309	N1841K	possibly damaging	Het
Arhgap25	T	A	6: 87,460,008	D620V	probably damaging	Het
Caps2	C	T	10: 112,199,727	T371I	possibly damaging	Het
Ccdc175	A	G	12: 72,140,020	I350T	possibly damaging	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Cdc42bpb	A	G	12: 111,299,196	L1434P	probably damaging	Het
Cdkl3	A	T	11: 52,026,839	E321V	probably damaging	Het
Clec2d	G	T	6: 129,183,190	V56L	possibly damaging	Het
Crygd	T	C	1: 65,063,246	D19G	probably damaging	Het
Dnah2	T	C	11: 69,496,606	I931M	possibly damaging	Het
Dst	A	T	1: 34,211,170	R4068S	probably damaging	Het
Fas	C	T	19: 34,320,553		probably benign	Het
G6pd2	T	A	5: 61,810,251	D456E	probably damaging	Het
Galnt18	G	A	7: 111,554,602	R272W	probably damaging	Het
Grb2	C	A	11: 115,645,825	G200W	probably damaging	Het
Herc4	A	G	10: 63,264,053	N85S	probably benign	Het
Ighv7-2	T	C	12: 113,912,107	D92G	probably damaging	Het
Itih3	A	G	14: 30,909,835	V765A	possibly damaging	Het
Itm2b	T	C	14: 73,363,120	N247D	probably benign	Het
Kcnd3	T	C	3: 105,666,999	V500A	probably benign	Het
Lrp2	C	T	2: 69,507,843	G1198R	probably damaging	Het
Ltb4r2	A	G	14: 55,761,987	T22A	probably damaging	Het
Mdga2	A	G	12: 66,655,362	V355A	probably damaging	Het
Megf8	T	A	7: 25,353,738	V1778E	probably benign	Het
Mroh2b	G	A	15: 4,944,966	E1143K	probably damaging	Het
Nbn	A	T	4: 15,979,389	Y458F	probably damaging	Het
Nlrc3	A	G	16: 3,963,992	C534R	probably benign	Het
Nup155	A	G	15: 8,143,026	E832G	probably damaging	Het
Olfr1131	A	G	2: 87,628,829	Y122C	probably damaging	Het
Plcl2	A	G	17: 50,606,829	T289A	probably benign	Het
Ptprs	C	T	17: 56,434,990	R7Q	probably null	Het
Rab3ip	A	T	10: 116,918,960	D198E	possibly damaging	Het
Scaf4	A	T	16: 90,252,435	F255I	unknown	Het
Senp6	T	C	9: 80,126,155	S475P	probably benign	Het
Shpk	T	C	11: 73,203,959	L67P	probably damaging	Het
Sik3	T	A	9: 46,219,503	Y1246N	probably damaging	Het
Slc44a2	A	G	9: 21,353,724	Y686C	probably damaging	Het
Slc6a19	A	G	13: 73,700,566	V23A	probably benign	Het
Slit3	A	T	11: 35,544,748	I169F	possibly damaging	Het
Stxbp5l	A	G	16: 37,236,275	V379A	possibly damaging	Het
Tex2	T	C	11: 106,506,864		probably null	Het
Tnpo3	A	G	6: 29,586,144	V149A	possibly damaging	Het
Vmn1r158	T	A	7: 22,790,390	R131S	probably benign	Het
Vmn2r24	T	A	6: 123,815,399	C562S	probably damaging	Het
Wipi1	T	C	11: 109,577,664	N368S	probably benign	Het
Zbtb41	T	C	1: 139,424,093	S315P	probably damaging	Het

Other mutations in Cops3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01957:Cops3	APN	11	59821391	splice site	probably benign
IGL02622:Cops3	APN	11	59833038	missense	probably benign	0.26
IGL02657:Cops3	APN	11	59830217	missense	probably damaging	0.99
IGL03271:Cops3	APN	11	59833063	missense	probably damaging	0.99
IGL03400:Cops3	APN	11	59818088	missense	probably benign	0.02
R0449:Cops3	UTSW	11	59818417	critical splice donor site	probably null
R0699:Cops3	UTSW	11	59826322	missense	probably damaging	1.00
R1485:Cops3	UTSW	11	59827889	missense	possibly damaging	0.85
R1894:Cops3	UTSW	11	59820018	missense	probably benign	0.00
R2265:Cops3	UTSW	11	59827890	missense	probably benign	0.06
R3790:Cops3	UTSW	11	59827971	missense	probably benign	0.00
R4540:Cops3	UTSW	11	59830154	missense	probably damaging	1.00
R4548:Cops3	UTSW	11	59827845	critical splice donor site	probably null
R4930:Cops3	UTSW	11	59835367	intron	probably benign
R5028:Cops3	UTSW	11	59818030	unclassified	probably benign
R5150:Cops3	UTSW	11	59820013	missense	probably damaging	0.99
R5319:Cops3	UTSW	11	59827936	missense	possibly damaging	0.78
R5436:Cops3	UTSW	11	59824345	missense	probably damaging	1.00
R5789:Cops3	UTSW	11	59830280	intron	probably benign
R6211:Cops3	UTSW	11	59817901	unclassified	probably benign
R6364:Cops3	UTSW	11	59835404	intron	probably benign
R6442:Cops3	UTSW	11	59827954	missense	probably benign	0.06
R6479:Cops3	UTSW	11	59833072	missense	probably benign	0.34
R6622:Cops3	UTSW	11	59833134	missense	probably damaging	0.99
R8698:Cops3	UTSW	11	59818060	missense	probably damaging	0.96
R8803:Cops3	UTSW	11	59827976	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCAACAGCTTCTCTCAGTG -3'
(R):5'- AAAACCAGGATTTGTGTTGGG -3'

Sequencing Primer
(F):5'- GCAACAGCTTCTCTCAGTGTAGAAG -3'
(R):5'- GCGATGTATTTTCTGAAAGTACACTG -3'

Posted On

2014-09-17