Incidental Mutation 'R2077:Grb2'
ID229231
Institutional Source Beutler Lab
Gene Symbol Grb2
Ensembl Gene ENSMUSG00000059923
Gene Namegrowth factor receptor bound protein 2
Synonyms
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115644045-115708597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115645825 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 200 (G200W)
Ref Sequence ENSEMBL: ENSMUSP00000102106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021090] [ENSMUST00000106495] [ENSMUST00000106497] [ENSMUST00000106499] [ENSMUST00000135065]
Predicted Effect probably damaging
Transcript: ENSMUST00000021090
AA Change: G200W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021090
Gene: ENSMUSG00000059923
AA Change: G200W

DomainStartEndE-ValueType
SH3 1 57 2.31e-21 SMART
SH2 58 141 2.97e-35 SMART
SH3 159 214 5.55e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106495
AA Change: G186W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102104
Gene: ENSMUSG00000059923
AA Change: G186W

DomainStartEndE-ValueType
SH3 1 57 2.31e-21 SMART
SH2 58 141 2.97e-35 SMART
SH3 143 200 2.08e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106497
AA Change: G200W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102106
Gene: ENSMUSG00000059923
AA Change: G200W

DomainStartEndE-ValueType
SH3 1 57 2.31e-21 SMART
SH2 58 141 2.97e-35 SMART
SH3 159 214 5.55e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106499
AA Change: G159W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102108
Gene: ENSMUSG00000059923
AA Change: G159W

DomainStartEndE-ValueType
SH3 1 57 2.31e-21 SMART
SH2 16 100 1.36e0 SMART
SH3 118 173 5.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135065
SMART Domains Protein: ENSMUSP00000117539
Gene: ENSMUSG00000059923

DomainStartEndE-ValueType
SH3 1 57 1.4e-23 SMART
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Three alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack expanded inner cell masses, show only a few endodermal cells, and die by embryonic day 7.5. Heterozygotes have defective T cell signaling and lack the cardiac hypertrophy response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Grb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Hill_country UTSW 11 115645872 missense probably benign 0.06
ANU74:Grb2 UTSW 11 115645907 missense probably benign
R0003:Grb2 UTSW 11 115655425 missense probably damaging 0.97
R4260:Grb2 UTSW 11 115649816 missense probably damaging 0.96
R5796:Grb2 UTSW 11 115645872 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGGCATTATGAAATCAAACACCCC -3'
(R):5'- TGGCAGCATGAGAAACACCG -3'

Sequencing Primer
(F):5'- CCAAAGTTGCAACCCAATGAGAGG -3'
(R):5'- TGAGAAACACCGCTTCCCTG -3'
Posted On2014-09-17