Incidental Mutation 'R2077:Itih3'
ID229236
Institutional Source Beutler Lab
Gene Symbol Itih3
Ensembl Gene ENSMUSG00000006522
Gene Nameinter-alpha trypsin inhibitor, heavy chain 3
SynonymsItih-3, Intin3
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30908572-30923760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30909835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 765 (V765A)
Ref Sequence ENSEMBL: ENSMUSP00000006697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000227995] [ENSMUST00000228114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006697
AA Change: V765A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: V765A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Blast:VWA 571 634 2e-21 BLAST
Pfam:ITI_HC_C 683 870 3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169620
Predicted Effect probably benign
Transcript: ENSMUST00000170415
AA Change: V575A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133027
Gene: ENSMUSG00000006522
AA Change: V575A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Pfam:ITI_HC_C 503 680 1.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226179
Predicted Effect probably benign
Transcript: ENSMUST00000226547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227181
Predicted Effect probably benign
Transcript: ENSMUST00000227995
AA Change: V575A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228114
Meta Mutation Damage Score 0.4081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Itih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Itih3 APN 14 30909781 missense probably damaging 0.98
IGL01359:Itih3 APN 14 30917772 missense probably damaging 1.00
IGL01965:Itih3 APN 14 30915720 missense probably damaging 0.99
IGL02435:Itih3 APN 14 30915754 missense probably damaging 0.99
IGL02539:Itih3 APN 14 30912664 missense probably benign 0.03
IGL02637:Itih3 APN 14 30915660 missense probably benign 0.00
IGL02958:Itih3 APN 14 30913182 missense probably benign 0.00
IGL03253:Itih3 APN 14 30911923 critical splice donor site probably null
K2124:Itih3 UTSW 14 30912687 missense probably benign 0.40
R0321:Itih3 UTSW 14 30912106 missense probably damaging 0.99
R0466:Itih3 UTSW 14 30912874 critical splice donor site probably null
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1633:Itih3 UTSW 14 30917398 missense possibly damaging 0.46
R1982:Itih3 UTSW 14 30923583 unclassified probably benign
R2056:Itih3 UTSW 14 30909524 splice site probably null
R2417:Itih3 UTSW 14 30917664 missense probably benign 0.04
R3624:Itih3 UTSW 14 30914743 missense probably damaging 1.00
R3794:Itih3 UTSW 14 30918394 missense probably damaging 1.00
R4676:Itih3 UTSW 14 30918949 missense probably null 1.00
R4676:Itih3 UTSW 14 30921686 missense possibly damaging 0.91
R5198:Itih3 UTSW 14 30912649 missense probably benign 0.07
R5429:Itih3 UTSW 14 30923521 missense probably benign 0.00
R6379:Itih3 UTSW 14 30909724 missense probably damaging 1.00
R6740:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6752:Itih3 UTSW 14 30923489 missense possibly damaging 0.76
R6765:Itih3 UTSW 14 30909473 missense probably benign
R6785:Itih3 UTSW 14 30912615 critical splice donor site probably null
R6871:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6935:Itih3 UTSW 14 30912702 missense possibly damaging 0.82
R7133:Itih3 UTSW 14 30917698 missense probably damaging 1.00
R7419:Itih3 UTSW 14 30914773 missense probably benign 0.41
R7592:Itih3 UTSW 14 30908765 missense probably damaging 0.98
R7598:Itih3 UTSW 14 30917377 missense possibly damaging 0.95
R7662:Itih3 UTSW 14 30917330 missense probably benign 0.00
R8183:Itih3 UTSW 14 30909476 missense probably benign
R8682:Itih3 UTSW 14 30920716 missense possibly damaging 0.81
R8723:Itih3 UTSW 14 30908804 missense probably damaging 1.00
R8794:Itih3 UTSW 14 30912897 missense possibly damaging 0.71
Y5408:Itih3 UTSW 14 30921945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTAACTAAGCAGCCTGC -3'
(R):5'- AAGGTCCATTCTGTAGAGGGC -3'

Sequencing Primer
(F):5'- CAGTGTTAGCATTTCATACCCAGCAG -3'
(R):5'- TCCATTCTGTAGAGGGCACAGATAAC -3'
Posted On2014-09-17