Incidental Mutation 'R2077:Mroh2b'
ID229239
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4944966 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1143 (E1143K)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: E1143K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: E1143K

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCCTGTTGAGTCGTTTACAGAC -3'
(R):5'- TTCCTGATGGGCTGCTTACC -3'

Sequencing Primer
(F):5'- ACAGACTAGTTTATGTTCCCTTTGG -3'
(R):5'- TGCTTACCTGCAGGGGTC -3'
Posted On2014-09-17