Mutagenetix > Incidental Mutation

Incidental Mutation 'R2077:Plcl2'

229244

Institutional Source

Beutler Lab

Gene Symbol

Plcl2

Ensembl Gene

ENSMUSG00000038910

Gene Name

phospholipase C-like 2

Synonyms

PRIP-2, Plce2

MMRRC Submission

040082-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.334) question?

Stock #

R2077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50509547-50688493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50606829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 289 (T289A)

Ref Sequence

ENSEMBL: ENSMUSP00000046584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043938]

AlphaFold

Q8K394

Predicted Effect

probably benign
Transcript: ENSMUST00000043938
AA Change: T289A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: T289A

Domain	Start	End	E-Value	Type
low complexity region	20	49	N/A	INTRINSIC
PH	143	254	2.88e-5	SMART
Pfam:EF-hand_like	344	426	3.7e-29	PFAM
PLCXc	427	571	2.19e-84	SMART
PLCYc	619	735	4.37e-61	SMART
C2	756	862	3.45e-19	SMART

Meta Mutation Damage Score

0.0704

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	A	4: 144,457,034		probably benign	Het
Abhd16b	A	C	2: 181,493,416	D37A	probably benign	Het
Acp7	T	C	7: 28,629,482	E91G	probably damaging	Het
Alms1	T	A	6: 85,622,309	N1841K	possibly damaging	Het
Arhgap25	T	A	6: 87,460,008	D620V	probably damaging	Het
Caps2	C	T	10: 112,199,727	T371I	possibly damaging	Het
Ccdc175	A	G	12: 72,140,020	I350T	possibly damaging	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Cdc42bpb	A	G	12: 111,299,196	L1434P	probably damaging	Het
Cdkl3	A	T	11: 52,026,839	E321V	probably damaging	Het
Clec2d	G	T	6: 129,183,190	V56L	possibly damaging	Het
Cops3	A	T	11: 59,824,310	S301T	possibly damaging	Het
Crygd	T	C	1: 65,063,246	D19G	probably damaging	Het
Dnah2	T	C	11: 69,496,606	I931M	possibly damaging	Het
Dst	A	T	1: 34,211,170	R4068S	probably damaging	Het
Fas	C	T	19: 34,320,553		probably benign	Het
G6pd2	T	A	5: 61,810,251	D456E	probably damaging	Het
Galnt18	G	A	7: 111,554,602	R272W	probably damaging	Het
Grb2	C	A	11: 115,645,825	G200W	probably damaging	Het
Herc4	A	G	10: 63,264,053	N85S	probably benign	Het
Ighv7-2	T	C	12: 113,912,107	D92G	probably damaging	Het
Itih3	A	G	14: 30,909,835	V765A	possibly damaging	Het
Itm2b	T	C	14: 73,363,120	N247D	probably benign	Het
Kcnd3	T	C	3: 105,666,999	V500A	probably benign	Het
Lrp2	C	T	2: 69,507,843	G1198R	probably damaging	Het
Ltb4r2	A	G	14: 55,761,987	T22A	probably damaging	Het
Mdga2	A	G	12: 66,655,362	V355A	probably damaging	Het
Megf8	T	A	7: 25,353,738	V1778E	probably benign	Het
Mroh2b	G	A	15: 4,944,966	E1143K	probably damaging	Het
Nbn	A	T	4: 15,979,389	Y458F	probably damaging	Het
Nlrc3	A	G	16: 3,963,992	C534R	probably benign	Het
Nup155	A	G	15: 8,143,026	E832G	probably damaging	Het
Olfr1131	A	G	2: 87,628,829	Y122C	probably damaging	Het
Ptprs	C	T	17: 56,434,990	R7Q	probably null	Het
Rab3ip	A	T	10: 116,918,960	D198E	possibly damaging	Het
Scaf4	A	T	16: 90,252,435	F255I	unknown	Het
Senp6	T	C	9: 80,126,155	S475P	probably benign	Het
Shpk	T	C	11: 73,203,959	L67P	probably damaging	Het
Sik3	T	A	9: 46,219,503	Y1246N	probably damaging	Het
Slc44a2	A	G	9: 21,353,724	Y686C	probably damaging	Het
Slc6a19	A	G	13: 73,700,566	V23A	probably benign	Het
Slit3	A	T	11: 35,544,748	I169F	possibly damaging	Het
Stxbp5l	A	G	16: 37,236,275	V379A	possibly damaging	Het
Tex2	T	C	11: 106,506,864		probably null	Het
Tnpo3	A	G	6: 29,586,144	V149A	possibly damaging	Het
Vmn1r158	T	A	7: 22,790,390	R131S	probably benign	Het
Vmn2r24	T	A	6: 123,815,399	C562S	probably damaging	Het
Wipi1	T	C	11: 109,577,664	N368S	probably benign	Het
Zbtb41	T	C	1: 139,424,093	S315P	probably damaging	Het

Other mutations in Plcl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Plcl2	APN	17	50606920	missense	probably benign	0.01
IGL01746:Plcl2	APN	17	50607696	missense	probably benign	0.00
IGL02227:Plcl2	APN	17	50606397	missense	probably damaging	0.97
IGL02232:Plcl2	APN	17	50606641	missense	possibly damaging	0.66
IGL02878:Plcl2	APN	17	50607355	missense	probably damaging	1.00
IGL02985:Plcl2	APN	17	50687814	nonsense	probably null
acerbic	UTSW	17	50608113	missense	probably damaging	1.00
Balsamic	UTSW	17	50607661	missense	probably damaging	1.00
Bastante	UTSW	17	50606361	nonsense	probably null
italietta	UTSW	17	50608762	missense	probably damaging	1.00
Oxalic	UTSW	17	50608099	missense	probably damaging	1.00
Parece	UTSW	17	50607846	missense	probably damaging	0.99
picolinic	UTSW	17	50668160	splice site	probably null
ranch	UTSW	17	50509929	missense	probably benign	0.00
verdad	UTSW	17	50608081	missense	probably damaging	1.00
vinagrette	UTSW	17	50606856	nonsense	probably null
BB007:Plcl2	UTSW	17	50606803	missense	probably benign
BB017:Plcl2	UTSW	17	50606803	missense	probably benign
IGL03014:Plcl2	UTSW	17	50611001	missense	possibly damaging	0.65
R0110:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0190:Plcl2	UTSW	17	50607643	missense	probably benign
R0280:Plcl2	UTSW	17	50607034	missense	probably damaging	1.00
R0414:Plcl2	UTSW	17	50607955	missense	possibly damaging	0.90
R0450:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0760:Plcl2	UTSW	17	50608774	missense	possibly damaging	0.82
R1134:Plcl2	UTSW	17	50608110	missense	probably benign
R1168:Plcl2	UTSW	17	50607072	missense	possibly damaging	0.49
R1381:Plcl2	UTSW	17	50607729	missense	probably damaging	0.99
R1748:Plcl2	UTSW	17	50606798	missense	probably benign
R1856:Plcl2	UTSW	17	50607850	missense	probably benign	0.13
R1958:Plcl2	UTSW	17	50608081	missense	probably damaging	1.00
R2016:Plcl2	UTSW	17	50606694	missense	probably damaging	1.00
R2057:Plcl2	UTSW	17	50668111	splice site	probably null
R2247:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R3083:Plcl2	UTSW	17	50687744	missense	probably benign	0.06
R4153:Plcl2	UTSW	17	50606361	nonsense	probably null
R4574:Plcl2	UTSW	17	50607846	missense	probably damaging	0.99
R4870:Plcl2	UTSW	17	50607226	missense	possibly damaging	0.46
R5030:Plcl2	UTSW	17	50607319	missense	possibly damaging	0.92
R5330:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5331:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5503:Plcl2	UTSW	17	50509929	missense	probably benign	0.00
R5920:Plcl2	UTSW	17	50608675	missense	probably damaging	0.99
R6238:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R6378:Plcl2	UTSW	17	50668160	splice site	probably null
R6603:Plcl2	UTSW	17	50607117	missense	probably benign	0.03
R6633:Plcl2	UTSW	17	50640140	missense	probably benign	0.00
R7113:Plcl2	UTSW	17	50606464	missense	probably damaging	1.00
R7466:Plcl2	UTSW	17	50608468	missense	probably damaging	1.00
R7665:Plcl2	UTSW	17	50607157	missense	probably benign	0.00
R7930:Plcl2	UTSW	17	50606803	missense	probably benign
R8114:Plcl2	UTSW	17	50687787	missense	probably damaging	0.97
R8152:Plcl2	UTSW	17	50607661	missense	probably damaging	1.00
R8208:Plcl2	UTSW	17	50608315	missense	probably damaging	1.00
R8853:Plcl2	UTSW	17	50606856	nonsense	probably null
R8911:Plcl2	UTSW	17	50608113	missense	probably damaging	1.00
R8940:Plcl2	UTSW	17	50608762	missense	probably damaging	1.00
R8979:Plcl2	UTSW	17	50640117	missense	possibly damaging	0.64
R9127:Plcl2	UTSW	17	50611004	missense	probably benign	0.05
R9253:Plcl2	UTSW	17	50608099	missense	probably damaging	1.00
R9453:Plcl2	UTSW	17	50608363	missense	probably damaging	1.00
R9469:Plcl2	UTSW	17	50606925	missense	probably benign	0.05
R9630:Plcl2	UTSW	17	50640119	missense	probably benign
X0026:Plcl2	UTSW	17	50607560	missense	probably benign	0.03
Z1088:Plcl2	UTSW	17	50606992	missense	probably damaging	1.00
Z1176:Plcl2	UTSW	17	50608456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGCCAATTCTGCAGATG -3'
(R):5'- CAAGAAACATCATAAGGTCCTTGG -3'

Sequencing Primer
(F):5'- GTTGCAAACATCTGGGTGAC -3'
(R):5'- CTTGGTATCAAGGAATTCTTTATTGC -3'

Posted On

2014-09-17