Incidental Mutation 'R2077:Plcl2'
ID229244
Institutional Source Beutler Lab
Gene Symbol Plcl2
Ensembl Gene ENSMUSG00000038910
Gene Namephospholipase C-like 2
SynonymsPRIP-2, Plce2
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50509547-50688493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50606829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 289 (T289A)
Ref Sequence ENSEMBL: ENSMUSP00000046584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043938]
Predicted Effect probably benign
Transcript: ENSMUST00000043938
AA Change: T289A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: T289A

DomainStartEndE-ValueType
low complexity region 20 49 N/A INTRINSIC
PH 143 254 2.88e-5 SMART
Pfam:EF-hand_like 344 426 3.7e-29 PFAM
PLCXc 427 571 2.19e-84 SMART
PLCYc 619 735 4.37e-61 SMART
C2 756 862 3.45e-19 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Plcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Plcl2 APN 17 50606920 missense probably benign 0.01
IGL01746:Plcl2 APN 17 50607696 missense probably benign 0.00
IGL02227:Plcl2 APN 17 50606397 missense probably damaging 0.97
IGL02232:Plcl2 APN 17 50606641 missense possibly damaging 0.66
IGL02878:Plcl2 APN 17 50607355 missense probably damaging 1.00
IGL02985:Plcl2 APN 17 50687814 nonsense probably null
Balsamic UTSW 17 50607661 missense probably damaging 1.00
Parece UTSW 17 50607846 missense probably damaging 0.99
picolinic UTSW 17 50668160 splice site probably null
R4153_plcl2_019 UTSW 17 50606361 nonsense probably null
verdad UTSW 17 50608081 missense probably damaging 1.00
BB007:Plcl2 UTSW 17 50606803 missense probably benign
BB017:Plcl2 UTSW 17 50606803 missense probably benign
IGL03014:Plcl2 UTSW 17 50611001 missense possibly damaging 0.65
R0110:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0190:Plcl2 UTSW 17 50607643 missense probably benign
R0280:Plcl2 UTSW 17 50607034 missense probably damaging 1.00
R0414:Plcl2 UTSW 17 50607955 missense possibly damaging 0.90
R0450:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0760:Plcl2 UTSW 17 50608774 missense possibly damaging 0.82
R1134:Plcl2 UTSW 17 50608110 missense probably benign
R1168:Plcl2 UTSW 17 50607072 missense possibly damaging 0.49
R1381:Plcl2 UTSW 17 50607729 missense probably damaging 0.99
R1748:Plcl2 UTSW 17 50606798 missense probably benign
R1856:Plcl2 UTSW 17 50607850 missense probably benign 0.13
R1958:Plcl2 UTSW 17 50608081 missense probably damaging 1.00
R2016:Plcl2 UTSW 17 50606694 missense probably damaging 1.00
R2057:Plcl2 UTSW 17 50668111 splice site probably null
R2247:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R3083:Plcl2 UTSW 17 50687744 missense probably benign 0.06
R4153:Plcl2 UTSW 17 50606361 nonsense probably null
R4574:Plcl2 UTSW 17 50607846 missense probably damaging 0.99
R4870:Plcl2 UTSW 17 50607226 missense possibly damaging 0.46
R5030:Plcl2 UTSW 17 50607319 missense possibly damaging 0.92
R5330:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5331:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5503:Plcl2 UTSW 17 50509929 missense probably benign 0.00
R5920:Plcl2 UTSW 17 50608675 missense probably damaging 0.99
R6238:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R6378:Plcl2 UTSW 17 50668160 splice site probably null
R6603:Plcl2 UTSW 17 50607117 missense probably benign 0.03
R6633:Plcl2 UTSW 17 50640140 missense probably benign 0.00
R7113:Plcl2 UTSW 17 50606464 missense probably damaging 1.00
R7466:Plcl2 UTSW 17 50608468 missense probably damaging 1.00
R7665:Plcl2 UTSW 17 50607157 missense probably benign 0.00
R7930:Plcl2 UTSW 17 50606803 missense probably benign
R8114:Plcl2 UTSW 17 50687787 missense probably damaging 0.97
R8152:Plcl2 UTSW 17 50607661 missense probably damaging 1.00
R8208:Plcl2 UTSW 17 50608315 missense probably damaging 1.00
R8853:Plcl2 UTSW 17 50606856 nonsense probably null
X0026:Plcl2 UTSW 17 50607560 missense probably benign 0.03
Z1088:Plcl2 UTSW 17 50606992 missense probably damaging 1.00
Z1176:Plcl2 UTSW 17 50608456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCCAATTCTGCAGATG -3'
(R):5'- CAAGAAACATCATAAGGTCCTTGG -3'

Sequencing Primer
(F):5'- GTTGCAAACATCTGGGTGAC -3'
(R):5'- CTTGGTATCAAGGAATTCTTTATTGC -3'
Posted On2014-09-17