Incidental Mutation 'R2077:Fas'
ID229247
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene NameFas (TNF receptor superfamily member 6)
SynonymsAPO-1, CD95, TNFR6, Tnfrsf6
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34290659-34327770 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 34320553 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691]
PDB Structure
Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025691
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Scaf4 A T 16: 90,252,435 F255I unknown Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34318618 missense probably damaging 1.00
IGL01677:Fas APN 19 34318818 missense probably benign 0.09
IGL01834:Fas APN 19 34318603 missense probably benign 0.33
IGL02130:Fas APN 19 34315295 missense probably benign 0.01
IGL02424:Fas APN 19 34327034 missense probably damaging 1.00
IGL02532:Fas APN 19 34316599 missense probably damaging 0.99
IGL02569:Fas APN 19 34320562 missense possibly damaging 0.93
bing UTSW 19 34316569 missense probably damaging 1.00
cherry UTSW 19 34327140 missense probably damaging 0.99
P0021:Fas UTSW 19 34307210 missense probably damaging 0.98
R0525:Fas UTSW 19 34319327 missense probably damaging 1.00
R0588:Fas UTSW 19 34327140 missense probably damaging 0.99
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R2283:Fas UTSW 19 34307249 missense probably damaging 1.00
R4154:Fas UTSW 19 34318828 missense possibly damaging 0.72
R5252:Fas UTSW 19 34316643 missense probably damaging 0.99
R5943:Fas UTSW 19 34320587 critical splice donor site probably null
R6474:Fas UTSW 19 34316569 missense probably damaging 1.00
R6837:Fas UTSW 19 34307164 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGTGGAACCTTTCAGAATC -3'
(R):5'- ACTGACAGTTCACATAACGGTAAAG -3'

Sequencing Primer
(F):5'- CTGAATGACTGAAAGAGCTCATC -3'
(R):5'- CGGTAAAGCCTAAAGTGTCACTGC -3'
Posted On2014-09-17