Incidental Mutation 'R2078:Cps1'
ID229250
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67195265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 937 (I937T)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027144
AA Change: I937T

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: I937T

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
X0024:Cps1 UTSW 1 67123247 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCAATGGCTTGAAGAATATG -3'
(R):5'- TTCAGGAACGTGTCACCCTG -3'

Sequencing Primer
(F):5'- TGTGAATTTTTGAAGGGAAGAGCC -3'
(R):5'- AACGTGTCACCCTGTGCTGAG -3'
Posted On2014-09-17