Mutagenetix > Incidental Mutations

Incidental Mutation 'R2078:Mertk'

229258

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

040083-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R2078 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128794458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 784 (T784I)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: T784I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: T784I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb6	C	A	1: 75,172,136	G55C	probably damaging	Het
Acss3	T	C	10: 106,967,041	T448A	possibly damaging	Het
Atxn7	A	G	14: 14,052,975	N138D	probably damaging	Het
Cacna2d4	A	T	6: 119,338,116	D869V	probably benign	Het
Cps1	T	G	1: 67,157,806	Y339D	probably damaging	Het
Cps1	T	C	1: 67,195,265	I937T	possibly damaging	Het
Dlgap4	T	C	2: 156,762,826	S261P	probably damaging	Het
Dusp6	T	C	10: 99,263,824	Y45H	probably damaging	Het
Ebag9	A	G	15: 44,636,804	N157S	probably damaging	Het
Exoc4	A	G	6: 33,910,587	D770G	probably benign	Het
Ezr	A	G	17: 6,782,642	M1T	probably null	Het
Fat4	A	G	3: 38,889,673	N905S	probably damaging	Het
Fcrlb	C	G	1: 170,908,081	R208P	probably damaging	Het
Flnb	T	C	14: 7,927,466	V1892A	probably damaging	Het
Gas2	G	A	7: 51,897,325	V75M	probably benign	Het
Gda	T	A	19: 21,400,672	D267V	probably damaging	Het
Gper1	A	T	5: 139,426,133	I78F	probably benign	Het
Hectd1	A	C	12: 51,748,542	I2368S	probably damaging	Het
Katna1	C	T	10: 7,743,569	P114S	probably benign	Het
Lce3c	G	A	3: 92,945,451	S73N	unknown	Het
Lrfn3	A	T	7: 30,360,454	D115E	possibly damaging	Het
Lrrc47	C	A	4: 154,019,431	T505K	probably damaging	Het
Mettl21e	T	A	1: 44,206,502	I195F	possibly damaging	Het
Mff	T	C	1: 82,741,921	S207P	probably damaging	Het
Mtmr6	A	G	14: 60,291,987		probably null	Het
Myh9	T	C	15: 77,763,912	K1788R	probably benign	Het
Narf	A	G	11: 121,245,394	T199A	probably benign	Het
Neurod6	A	G	6: 55,678,969	S228P	probably benign	Het
Notch4	A	T	17: 34,568,715		probably null	Het
Nyap2	T	C	1: 81,191,981	L151P	probably damaging	Het
Olfr1444	T	A	19: 12,862,387	V204E	probably benign	Het
P2ry1	A	G	3: 61,003,697	I86V	probably damaging	Het
Pafah1b2	G	T	9: 45,968,829	D183E	probably damaging	Het
Phldb1	T	C	9: 44,707,979	E179G	probably damaging	Het
Piezo2	T	C	18: 63,117,720	E436G	probably damaging	Het
Pkhd1l1	A	G	15: 44,527,767	I1514V	probably benign	Het
Plch1	A	G	3: 63,701,943	S948P	probably benign	Het
Rfc5	A	G	5: 117,380,803	V296A	probably benign	Het
Rnf150	A	T	8: 83,003,605	I255F	probably damaging	Het
Rsbn1	A	G	3: 103,961,523	D626G	probably damaging	Het
Sfswap	A	G	5: 129,516,107	D346G	possibly damaging	Het
Slc38a11	A	T	2: 65,330,384	F289I	possibly damaging	Het
Terf2ip	A	G	8: 112,015,403	N243S	probably benign	Het
Tmed5	A	T	5: 108,124,605	V209E	probably damaging	Het
Tmem63b	A	G	17: 45,663,536	S603P	possibly damaging	Het
Tomm20	T	C	8: 126,937,072	M121V	possibly damaging	Het
Tspan33	G	A	6: 29,709,971	V45I	probably benign	Het
Usp17la	A	T	7: 104,859,393	M1L	probably benign	Het
Vsig8	C	A	1: 172,563,289	D301E	probably benign	Het
Vwa8	T	A	14: 78,908,157	H91Q	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGTTAACTATGGGGCTTCAAC -3'
(R):5'- AGCACTGTGTTTCTCAGGTC -3'

Sequencing Primer
(F):5'- AACCCCATGTATTGCTGTGTCAG -3'
(R):5'- CTCAGGTCGTTTCATAGCCAGG -3'

Posted On

2014-09-17