Incidental Mutation 'R0157:Atp2b1'
ID22926
Institutional Source Beutler Lab
Gene Symbol Atp2b1
Ensembl Gene ENSMUSG00000019943
Gene NameATPase, Ca++ transporting, plasma membrane 1
SynonymsPMCA1, 2810442I22Rik, E130111D10Rik
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0157 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location98914406-99026143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98999947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 518 (I518T)
Ref Sequence ENSEMBL: ENSMUSP00000020107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020107] [ENSMUST00000219624]
Predicted Effect probably damaging
Transcript: ENSMUST00000020107
AA Change: I518T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943
AA Change: I518T

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.8e-3 SMART
low complexity region 138 156 N/A INTRINSIC
Pfam:E1-E2_ATPase 157 312 1.5e-28 PFAM
Pfam:E1-E2_ATPase 348 464 1.4e-13 PFAM
Pfam:HAD 472 806 6.9e-22 PFAM
Pfam:Cation_ATPase 492 614 8.8e-17 PFAM
Pfam:Hydrolase 605 809 5.8e-14 PFAM
Pfam:Hydrolase_3 764 842 7.2e-7 PFAM
transmembrane domain 855 877 N/A INTRINSIC
Pfam:Cation_ATPase_C 879 1061 1.2e-47 PFAM
low complexity region 1079 1092 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1103 1155 7.5e-31 PFAM
low complexity region 1176 1188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219090
Predicted Effect probably benign
Transcript: ENSMUST00000219624
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Atp2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Atp2b1 APN 10 99015020 missense possibly damaging 0.84
IGL00972:Atp2b1 APN 10 99015044 missense probably damaging 1.00
IGL00977:Atp2b1 APN 10 98986975 missense possibly damaging 0.88
IGL01154:Atp2b1 APN 10 98996888 missense probably damaging 1.00
IGL03073:Atp2b1 APN 10 98999851 missense probably damaging 1.00
IGL03081:Atp2b1 APN 10 98994813 splice site probably benign
PIT4453001:Atp2b1 UTSW 10 99016978 missense probably benign 0.00
R0200:Atp2b1 UTSW 10 98979814 nonsense probably null
R0899:Atp2b1 UTSW 10 99017031 critical splice donor site probably null
R0981:Atp2b1 UTSW 10 99015629 missense probably damaging 1.00
R1163:Atp2b1 UTSW 10 98979851 missense possibly damaging 0.91
R1569:Atp2b1 UTSW 10 98987326 missense probably benign 0.02
R1572:Atp2b1 UTSW 10 98994675 missense probably benign 0.10
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1721:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1782:Atp2b1 UTSW 10 99003201 missense probably benign 0.01
R1840:Atp2b1 UTSW 10 99022929 missense probably benign 0.00
R1867:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1868:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1944:Atp2b1 UTSW 10 99022931 missense probably damaging 0.97
R1984:Atp2b1 UTSW 10 99014492 missense possibly damaging 0.95
R2055:Atp2b1 UTSW 10 99014559 missense probably damaging 1.00
R2325:Atp2b1 UTSW 10 99018895 nonsense probably null
R2399:Atp2b1 UTSW 10 98999923 missense probably benign 0.02
R2876:Atp2b1 UTSW 10 98999745 missense probably damaging 0.96
R3762:Atp2b1 UTSW 10 99009489 missense probably damaging 1.00
R3776:Atp2b1 UTSW 10 98979869 frame shift probably null
R3808:Atp2b1 UTSW 10 99003148 missense possibly damaging 0.74
R3978:Atp2b1 UTSW 10 98996933 unclassified probably null
R4391:Atp2b1 UTSW 10 99003214 missense probably benign 0.00
R4825:Atp2b1 UTSW 10 99009564 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 99003170 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 98994809 critical splice donor site probably null
R6018:Atp2b1 UTSW 10 99010760 missense probably damaging 1.00
R6179:Atp2b1 UTSW 10 99022829 missense probably damaging 1.00
R6455:Atp2b1 UTSW 10 99016980 missense possibly damaging 0.76
R6496:Atp2b1 UTSW 10 99003337 missense probably damaging 0.98
R6786:Atp2b1 UTSW 10 99016959 missense probably damaging 1.00
R6814:Atp2b1 UTSW 10 99023015 missense possibly damaging 0.87
R7034:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7036:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7079:Atp2b1 UTSW 10 99018733 missense probably benign 0.01
R7216:Atp2b1 UTSW 10 98986977 missense probably benign 0.30
R7510:Atp2b1 UTSW 10 98993896 missense probably benign 0.01
R7562:Atp2b1 UTSW 10 99022805 splice site probably null
R7651:Atp2b1 UTSW 10 99016968 missense probably damaging 0.99
R7739:Atp2b1 UTSW 10 99001365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGGAATGCTACAGCTATCTGTTCAG -3'
(R):5'- AAACCCCTAAAGCGTGGGCTAGAC -3'

Sequencing Primer
(F):5'- CTATCTGTTCAGATAAAACAGGAACC -3'
(R):5'- tgaacctagaaggagagaatcac -3'
Posted On2013-04-16