Mutagenetix > Incidental Mutations

Incidental Mutation 'R2078:Sfswap'

229271

Institutional Source

Beutler Lab

Gene Symbol

Sfswap

Ensembl Gene

ENSMUSG00000029439

Gene Name

splicing factor SWAP

Synonyms

Sfrs8, 6330437E22Rik, 1190005N23Rik

MMRRC Submission

040083-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2078 (G1)

Quality Score

209

Status

Not validated

Chromosome

Chromosomal Location

129501221-129571384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129516107 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 346 (D346G)

Ref Sequence

ENSEMBL: ENSMUSP00000062413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053737
AA Change: D346G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: D346G

Domain	Start	End	E-Value	Type
low complexity region	22	30	N/A	INTRINSIC
DRY_EERY	33	157	1.15e-57	SMART
low complexity region	160	170	N/A	INTRINSIC
low complexity region	174	186	N/A	INTRINSIC
SWAP	209	262	3.94e-19	SMART
low complexity region	286	293	N/A	INTRINSIC
low complexity region	333	352	N/A	INTRINSIC
low complexity region	397	441	N/A	INTRINSIC
SWAP	456	507	9.55e-18	SMART
low complexity region	513	532	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	598	607	N/A	INTRINSIC
coiled coil region	631	686	N/A	INTRINSIC
low complexity region	741	788	N/A	INTRINSIC
low complexity region	797	821	N/A	INTRINSIC
low complexity region	840	865	N/A	INTRINSIC
low complexity region	871	888	N/A	INTRINSIC
low complexity region	889	905	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196698

SMART Domains

Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

Domain	Start	End	E-Value	Type
low complexity region	22	30	N/A	INTRINSIC
DRY_EERY	33	121	1.8e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200662

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb6	C	A	1: 75,172,136	G55C	probably damaging	Het
Acss3	T	C	10: 106,967,041	T448A	possibly damaging	Het
Atxn7	A	G	14: 14,052,975	N138D	probably damaging	Het
Cacna2d4	A	T	6: 119,338,116	D869V	probably benign	Het
Cps1	T	G	1: 67,157,806	Y339D	probably damaging	Het
Cps1	T	C	1: 67,195,265	I937T	possibly damaging	Het
Dlgap4	T	C	2: 156,762,826	S261P	probably damaging	Het
Dusp6	T	C	10: 99,263,824	Y45H	probably damaging	Het
Ebag9	A	G	15: 44,636,804	N157S	probably damaging	Het
Exoc4	A	G	6: 33,910,587	D770G	probably benign	Het
Ezr	A	G	17: 6,782,642	M1T	probably null	Het
Fat4	A	G	3: 38,889,673	N905S	probably damaging	Het
Fcrlb	C	G	1: 170,908,081	R208P	probably damaging	Het
Flnb	T	C	14: 7,927,466	V1892A	probably damaging	Het
Gas2	G	A	7: 51,897,325	V75M	probably benign	Het
Gda	T	A	19: 21,400,672	D267V	probably damaging	Het
Gper1	A	T	5: 139,426,133	I78F	probably benign	Het
Hectd1	A	C	12: 51,748,542	I2368S	probably damaging	Het
Katna1	C	T	10: 7,743,569	P114S	probably benign	Het
Lce3c	G	A	3: 92,945,451	S73N	unknown	Het
Lrfn3	A	T	7: 30,360,454	D115E	possibly damaging	Het
Lrrc47	C	A	4: 154,019,431	T505K	probably damaging	Het
Mertk	C	T	2: 128,794,458	T784I	probably damaging	Het
Mettl21e	T	A	1: 44,206,502	I195F	possibly damaging	Het
Mff	T	C	1: 82,741,921	S207P	probably damaging	Het
Mtmr6	A	G	14: 60,291,987		probably null	Het
Myh9	T	C	15: 77,763,912	K1788R	probably benign	Het
Narf	A	G	11: 121,245,394	T199A	probably benign	Het
Neurod6	A	G	6: 55,678,969	S228P	probably benign	Het
Notch4	A	T	17: 34,568,715		probably null	Het
Nyap2	T	C	1: 81,191,981	L151P	probably damaging	Het
Olfr1444	T	A	19: 12,862,387	V204E	probably benign	Het
P2ry1	A	G	3: 61,003,697	I86V	probably damaging	Het
Pafah1b2	G	T	9: 45,968,829	D183E	probably damaging	Het
Phldb1	T	C	9: 44,707,979	E179G	probably damaging	Het
Piezo2	T	C	18: 63,117,720	E436G	probably damaging	Het
Pkhd1l1	A	G	15: 44,527,767	I1514V	probably benign	Het
Plch1	A	G	3: 63,701,943	S948P	probably benign	Het
Rfc5	A	G	5: 117,380,803	V296A	probably benign	Het
Rnf150	A	T	8: 83,003,605	I255F	probably damaging	Het
Rsbn1	A	G	3: 103,961,523	D626G	probably damaging	Het
Slc38a11	A	T	2: 65,330,384	F289I	possibly damaging	Het
Terf2ip	A	G	8: 112,015,403	N243S	probably benign	Het
Tmed5	A	T	5: 108,124,605	V209E	probably damaging	Het
Tmem63b	A	G	17: 45,663,536	S603P	possibly damaging	Het
Tomm20	T	C	8: 126,937,072	M121V	possibly damaging	Het
Tspan33	G	A	6: 29,709,971	V45I	probably benign	Het
Usp17la	A	T	7: 104,859,393	M1L	probably benign	Het
Vsig8	C	A	1: 172,563,289	D301E	probably benign	Het
Vwa8	T	A	14: 78,908,157	H91Q	probably damaging	Het

Other mutations in Sfswap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Sfswap	APN	5	129513233	missense	probably damaging	1.00
IGL02064:Sfswap	APN	5	129560796	missense	probably benign	0.17
IGL02083:Sfswap	APN	5	129539791	missense	probably benign
IGL02378:Sfswap	APN	5	129539604	missense	probably damaging	1.00
FR4340:Sfswap	UTSW	5	129569751	unclassified	probably benign
FR4342:Sfswap	UTSW	5	129569757	unclassified	probably benign
FR4449:Sfswap	UTSW	5	129569748	unclassified	probably benign
FR4449:Sfswap	UTSW	5	129569749	unclassified	probably benign
FR4548:Sfswap	UTSW	5	129569749	unclassified	probably benign
FR4548:Sfswap	UTSW	5	129569755	unclassified	probably benign
FR4737:Sfswap	UTSW	5	129569756	unclassified	probably benign
FR4976:Sfswap	UTSW	5	129569751	unclassified	probably benign
I1329:Sfswap	UTSW	5	129507137	unclassified	probably benign
P0033:Sfswap	UTSW	5	129539755	missense	possibly damaging	0.60
R0184:Sfswap	UTSW	5	129507189	missense	probably damaging	0.97
R0233:Sfswap	UTSW	5	129554543	missense	possibly damaging	0.82
R0233:Sfswap	UTSW	5	129554543	missense	possibly damaging	0.82
R0414:Sfswap	UTSW	5	129504051	missense	possibly damaging	0.83
R0415:Sfswap	UTSW	5	129504126	missense	probably damaging	1.00
R0570:Sfswap	UTSW	5	129503978	splice site	probably benign
R1018:Sfswap	UTSW	5	129554576	missense	possibly damaging	0.91
R1173:Sfswap	UTSW	5	129507143	critical splice acceptor site	probably null
R1298:Sfswap	UTSW	5	129541378	missense	probably benign	0.14
R1723:Sfswap	UTSW	5	129539694	missense	probably benign
R1783:Sfswap	UTSW	5	129513240	missense	possibly damaging	0.92
R1828:Sfswap	UTSW	5	129513084	missense	probably damaging	1.00
R1879:Sfswap	UTSW	5	129541328	missense	probably benign	0.01
R2349:Sfswap	UTSW	5	129569738	missense	possibly damaging	0.87
R3757:Sfswap	UTSW	5	129513234	missense	probably damaging	1.00
R4093:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4094:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4095:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4785:Sfswap	UTSW	5	129513083	missense	probably damaging	1.00
R5139:Sfswap	UTSW	5	129571009	missense	possibly damaging	0.73
R5355:Sfswap	UTSW	5	129539746	missense	probably benign	0.09
R5481:Sfswap	UTSW	5	129514818	missense	probably damaging	0.98
R5600:Sfswap	UTSW	5	129513158	missense	probably damaging	1.00
R5686:Sfswap	UTSW	5	129514818	missense	probably damaging	0.98
R5906:Sfswap	UTSW	5	129542043	missense	probably benign	0.22
R6332:Sfswap	UTSW	5	129571041	missense	possibly damaging	0.91
R6738:Sfswap	UTSW	5	129541441	missense	probably damaging	0.98
R6743:Sfswap	UTSW	5	129550819	nonsense	probably null
R7371:Sfswap	UTSW	5	129543241	missense	probably benign	0.01
RF003:Sfswap	UTSW	5	129569764	unclassified	probably benign
RF042:Sfswap	UTSW	5	129569743	unclassified	probably benign
RF049:Sfswap	UTSW	5	129569744	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GACATGCTGACAGTACCATAAGG -3'
(R):5'- TCAGGAATGCAGAGCCACAG -3'

Sequencing Primer
(F):5'- GGCCAAATGTCTTCTCTG -3'
(R):5'- CAGGCCAGGCAACCATG -3'

Posted On

2014-09-17