Incidental Mutation 'R2078:Tspan33'
ID229273
Institutional Source Beutler Lab
Gene Symbol Tspan33
Ensembl Gene ENSMUSG00000001763
Gene Nametetraspanin 33
SynonymsPenumbra, 1300010A20Rik, Pen
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29694222-29718559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29709971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 45 (V45I)
Ref Sequence ENSEMBL: ENSMUSP00000110905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046750] [ENSMUST00000115250]
Predicted Effect probably benign
Transcript: ENSMUST00000046750
AA Change: V45I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045282
Gene: ENSMUSG00000001763
AA Change: V45I

DomainStartEndE-ValueType
Pfam:Tetraspannin 21 264 3.8e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115250
AA Change: V45I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110905
Gene: ENSMUSG00000001763
AA Change: V45I

DomainStartEndE-ValueType
Pfam:Tetraspannin 21 263 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137925
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tetraspanin family which typically have four transmembrane domains. The encoded protein may be involved in the regulation of erythropoiesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null mutation display anemia and partial penetrance of red blood cell abnormalities, splenomegaly, monocytosis, thrombocytopenia, reticulocytosis, and extramedullary hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Tspan33
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0227:Tspan33 UTSW 6 29713478 missense probably damaging 0.96
R0329:Tspan33 UTSW 6 29711092 critical splice donor site probably null
R0330:Tspan33 UTSW 6 29711092 critical splice donor site probably null
R1554:Tspan33 UTSW 6 29711082 missense possibly damaging 0.84
R5705:Tspan33 UTSW 6 29717233 missense probably benign 0.07
R5815:Tspan33 UTSW 6 29710689 missense probably damaging 1.00
R7101:Tspan33 UTSW 6 29716784 missense probably benign 0.02
R7375:Tspan33 UTSW 6 29713520 missense probably benign 0.17
R7535:Tspan33 UTSW 6 29717589 missense possibly damaging 0.48
R7570:Tspan33 UTSW 6 29717338 missense probably damaging 1.00
RF011:Tspan33 UTSW 6 29716730 missense probably damaging 1.00
RF049:Tspan33 UTSW 6 29709998 critical splice donor site probably benign
X0020:Tspan33 UTSW 6 29694533 missense probably benign 0.00
X0020:Tspan33 UTSW 6 29710631 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCCTGAGTTATACCTCCAGAC -3'
(R):5'- TCAGACAGATCTTGGGAGGG -3'

Sequencing Primer
(F):5'- TCCATCTGTGAAATGCGGAC -3'
(R):5'- GGGGCTCAGGAAAACCCAC -3'
Posted On2014-09-17