Incidental Mutation 'R2078:Cacna2d4'
ID229276
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119338116 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 869 (D869V)
Ref Sequence ENSEMBL: ENSMUSP00000140197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]
Predicted Effect probably benign
Transcript: ENSMUST00000037434
AA Change: D894V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: D894V

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186203
Predicted Effect probably benign
Transcript: ENSMUST00000186622
AA Change: D869V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: D869V

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
Sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0612:Cacna2d4 UTSW 6 119281718 splice site probably benign
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0836:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 intron probably null
R3976:Cacna2d4 UTSW 6 119278173 intron probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R6931:Cacna2d4 UTSW 6 119282234 missense possibly damaging 0.49
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
R7363:Cacna2d4 UTSW 6 119343978 missense probably damaging 1.00
R7371:Cacna2d4 UTSW 6 119308709 missense probably benign 0.07
R7382:Cacna2d4 UTSW 6 119239087 missense probably damaging 1.00
R7431:Cacna2d4 UTSW 6 119244276 missense probably damaging 0.98
R7517:Cacna2d4 UTSW 6 119271921 missense probably benign 0.01
R7527:Cacna2d4 UTSW 6 119271247 missense probably benign 0.00
R7529:Cacna2d4 UTSW 6 119270766 missense probably benign 0.01
R7710:Cacna2d4 UTSW 6 119274239 missense probably benign 0.05
R7880:Cacna2d4 UTSW 6 119349155 missense probably damaging 0.99
R7963:Cacna2d4 UTSW 6 119349155 missense probably damaging 0.99
R8007:Cacna2d4 UTSW 6 119312444 missense probably benign
RF023:Cacna2d4 UTSW 6 119268230 missense probably benign 0.19
Z1176:Cacna2d4 UTSW 6 119312450 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCAGTGCAACGCTGTAGAG -3'
(R):5'- TTCTACCCAGATTTGCACCG -3'

Sequencing Primer
(F):5'- GGACACTGTAAGTTCTTCCCAGAG -3'
(R):5'- CCAGATTTGCACCGTTATAGTGGAAG -3'
Posted On2014-09-17