Incidental Mutation 'R2078:Phldb1'
ID229286
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Namepleckstrin homology like domain, family B, member 1
SynonymsLL5A, D330037A14Rik
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44686304-44735198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44707979 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000114773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123310] [ENSMUST00000134465] [ENSMUST00000138356] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000154723] [ENSMUST00000156918]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034611
AA Change: E819G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: E819G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123123
Predicted Effect probably benign
Transcript: ENSMUST00000123310
SMART Domains Protein: ENSMUSP00000122374
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 185 193 N/A INTRINSIC
coiled coil region 232 259 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128326
AA Change: E311G
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134465
AA Change: E819G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: E819G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138356
AA Change: E819G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: E819G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144251
AA Change: E179G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: E179G

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147495
AA Change: E819G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: E819G

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148344
AA Change: E563G
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: E563G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154723
AA Change: E72G
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537
AA Change: E72G

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156918
AA Change: E136G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: E136G

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44711146 critical splice donor site probably null
IGL01089:Phldb1 APN 9 44707887 nonsense probably null
IGL01374:Phldb1 APN 9 44696167 missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44718357 unclassified probably null
IGL02148:Phldb1 APN 9 44696072 missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44715906 missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44700950 missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44715403 missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44716474 missense probably benign 0.00
IGL02471:Phldb1 APN 9 44711233 missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44710926 missense probably benign 0.00
IGL03335:Phldb1 APN 9 44728069 missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44715960 missense probably benign 0.00
R0070:Phldb1 UTSW 9 44707904 missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44711706 start codon destroyed probably null
R0344:Phldb1 UTSW 9 44701667 missense probably benign 0.14
R0364:Phldb1 UTSW 9 44699335 splice site probably benign
R0622:Phldb1 UTSW 9 44715852 missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44699636 missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44716633 missense probably benign 0.17
R1498:Phldb1 UTSW 9 44701618 missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44718322 missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44715433 missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44715420 missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44715748 missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44716545 missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44728036 missense possibly damaging 0.67
R2208:Phldb1 UTSW 9 44696131 missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44726025 missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44718288 missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44694394 missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44715831 missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44711027 missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44696092 missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44704158 missense probably benign 0.04
R5651:Phldb1 UTSW 9 44711903 missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44711651 missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44696117 missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44696140 missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44696143 missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44711900 missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44699568 missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44716062 missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44694408 missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44694424 missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44696135 missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44711904 missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44694047 missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44715372 missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44697946 missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44687677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAATGTGACTCAACCCCTG -3'
(R):5'- TGGGATCAGTGCTCCAGATC -3'

Sequencing Primer
(F):5'- AATGTGACTCAACCCCTGGTTACTAG -3'
(R):5'- ATCAGTGCTCCAGATCGCGATG -3'
Posted On2014-09-17