Incidental Mutation 'R2078:Katna1'
ID229288
Institutional Source Beutler Lab
Gene Symbol Katna1
Ensembl Gene ENSMUSG00000019794
Gene Namekatanin p60 (ATPase-containing) subunit A1
Synonyms
MMRRC Submission 040083-MU
Accession Numbers

Ncbi RefSeq: NM_011835.2; MGI:1344353

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location7726000-7763150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7743569 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 114 (P114S)
Ref Sequence ENSEMBL: ENSMUSP00000132514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019929] [ENSMUST00000165806] [ENSMUST00000173400]
Predicted Effect probably benign
Transcript: ENSMUST00000019929
AA Change: P112S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019929
Gene: ENSMUSG00000019794
AA Change: P112S

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 2e-44 PDB
AAA 241 383 5.2e-22 SMART
low complexity region 387 400 N/A INTRINSIC
Pfam:Vps4_C 438 489 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165806
AA Change: P114S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132514
Gene: ENSMUSG00000019794
AA Change: P114S

DomainStartEndE-ValueType
PDB:2RPA|A 1 74 6e-46 PDB
AAA 243 385 3.23e-20 SMART
low complexity region 389 402 N/A INTRINSIC
Pfam:Vps4_C 440 491 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173400
SMART Domains Protein: ENSMUSP00000133588
Gene: ENSMUSG00000019794

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-47 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174654
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. This gene encodes the p80 subunit. This protein is a member of the AAA family of ATPases. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2011]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Katna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Katna1 APN 10 7762804 missense probably damaging 1.00
IGL00332:Katna1 APN 10 7762994 utr 3 prime probably benign
IGL01385:Katna1 APN 10 7752810 missense probably damaging 1.00
IGL01592:Katna1 APN 10 7741454 missense probably damaging 1.00
P0018:Katna1 UTSW 10 7741459 missense probably damaging 1.00
R0310:Katna1 UTSW 10 7743749 intron probably benign
R2975:Katna1 UTSW 10 7743709 missense probably benign 0.01
R3978:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R3979:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R4477:Katna1 UTSW 10 7738830 missense probably damaging 0.98
R4480:Katna1 UTSW 10 7738830 missense probably damaging 0.98
R5796:Katna1 UTSW 10 7760811 missense probably damaging 0.98
Z1176:Katna1 UTSW 10 7759785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGTACACTGATGTCCTGAG -3'
(R):5'- TCATTCTGAAGACGGTAACATTTAC -3'

Sequencing Primer
(F):5'- CACTGATGTCCTGAGTAGAAGTC -3'
(R):5'- GTAACATTTACCTTTTCCTCTCTTCC -3'
Posted On2014-09-17