Incidental Mutation 'R0157:Olfr314'
ID22929
Institutional Source Beutler Lab
Gene Symbol Olfr314
Ensembl Gene ENSMUSG00000059504
Gene Nameolfactory receptor 314
SynonymsMOR278-2, GA_x6K02T2NKPP-622179-621244
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0157 (G1)
Quality Score224
Status Validated (trace)
Chromosome11
Chromosomal Location58782952-58788768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58787059 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 275 (F275S)
Ref Sequence ENSEMBL: ENSMUSP00000145387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076393] [ENSMUST00000205189]
Predicted Effect probably damaging
Transcript: ENSMUST00000076393
AA Change: F275S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075729
Gene: ENSMUSG00000059504
AA Change: F275S

DomainStartEndE-ValueType
Pfam:7tm_4 26 306 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 249 2.1e-6 PFAM
Pfam:7tm_1 39 288 2.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205189
AA Change: F275S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145387
Gene: ENSMUSG00000059504
AA Change: F275S

DomainStartEndE-ValueType
Pfam:7tm_4 26 259 8.9e-42 PFAM
Pfam:7TM_GPCR_Srsx 33 246 9.4e-6 PFAM
Pfam:7tm_1 39 259 1.1e-25 PFAM
Meta Mutation Damage Score 0.7213 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Olfr314
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02036:Olfr314 APN 11 58787097 missense probably damaging 1.00
IGL02268:Olfr314 APN 11 58786725 missense probably benign 0.39
IGL02743:Olfr314 APN 11 58786780 nonsense probably null
R0622:Olfr314 UTSW 11 58786341 missense probably damaging 1.00
R0926:Olfr314 UTSW 11 58787109 missense probably damaging 1.00
R1985:Olfr314 UTSW 11 58786384 missense probably damaging 0.99
R2273:Olfr314 UTSW 11 58786666 missense probably benign 0.00
R2274:Olfr314 UTSW 11 58786666 missense probably benign 0.00
R5642:Olfr314 UTSW 11 58786828 missense probably damaging 1.00
R5770:Olfr314 UTSW 11 58786594 missense probably benign 0.39
R6292:Olfr314 UTSW 11 58786237 start codon destroyed probably null 0.94
R6813:Olfr314 UTSW 11 58786646 missense probably benign 0.06
R7285:Olfr314 UTSW 11 58786484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATATGCCACCCATTGCGCTATC -3'
(R):5'- TTGTACCTCCAGCTAGGTCCAAGC -3'

Sequencing Primer
(F):5'- CCAGTTTTGCAGCCGGAATG -3'
(R):5'- TAGGTCCAAGCCAGCCAAG -3'
Posted On2013-04-16