Incidental Mutation 'R2078:Atxn7'
ID229296
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Nameataxin 7
SynonymsA430107N12Rik, ataxin-7, Sca7
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13961440-14107302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14052975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 138 (N138D)
Ref Sequence ENSEMBL: ENSMUSP00000153613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
Predicted Effect probably damaging
Transcript: ENSMUST00000022257
AA Change: N138D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: N138D

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223714
AA Change: N138D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223880
AA Change: N138D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226073
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
Olfr1444 T A 19: 12,862,387 V204E probably benign Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14096324 splice site probably benign
IGL00782:Atxn7 APN 14 14096218 missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14100105 missense probably benign 0.00
IGL02828:Atxn7 APN 14 14090056 missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14100734 missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14052994 missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14100564 missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14087273 splice site probably benign
Estes_park UTSW 14 14096317 critical splice donor site probably null
Lumpy UTSW 14 14089446 nonsense probably null
Oestes_park UTSW 14 14096268 nonsense probably null
R0034:Atxn7 UTSW 14 14100846 missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14100317 missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14089465 splice site probably benign
R1169:Atxn7 UTSW 14 14095468 missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14096239 missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14089419 missense probably benign 0.25
R2275:Atxn7 UTSW 14 14013268 missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14100237 missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14100308 missense probably benign 0.00
R4230:Atxn7 UTSW 14 14100381 missense probably benign 0.00
R4588:Atxn7 UTSW 14 14096268 nonsense probably null
R4688:Atxn7 UTSW 14 14089288 missense probably benign 0.00
R4935:Atxn7 UTSW 14 14100401 missense probably benign
R5041:Atxn7 UTSW 14 14096317 critical splice donor site probably null
R5185:Atxn7 UTSW 14 14090063 missense probably benign 0.04
R5561:Atxn7 UTSW 14 14089260 missense probably benign 0.19
R5641:Atxn7 UTSW 14 14013638 missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14089446 nonsense probably null
R6549:Atxn7 UTSW 14 14013087 missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14099972 missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14095511 missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14100878 missense probably benign 0.08
R7402:Atxn7 UTSW 14 14095427 missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14100467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAATGCTCTGTATTTCAGCCC -3'
(R):5'- CCCTTCTATGAATTAAAAGGACTGC -3'

Sequencing Primer
(F):5'- AGCCCTCTATTAAGCCATTAGC -3'
(R):5'- AAGGGTGCTGATAAGCCT -3'
Posted On2014-09-17