Incidental Mutation 'R2079:BC035947'
ID229312
Institutional Source Beutler Lab
Gene Symbol BC035947
Ensembl Gene ENSMUSG00000090486
Gene NamecDNA sequence BC035947
Synonyms
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78497026-78512158 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 78511924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111] [ENSMUST00000170511]
Predicted Effect probably benign
Transcript: ENSMUST00000012331
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113524
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134947
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149732
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170511
AA Change: Y14H
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486
AA Change: Y14H

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in BC035947
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:BC035947 UTSW 1 78499016 missense possibly damaging 0.95
R2234:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R2235:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R3840:BC035947 UTSW 1 78497845 missense probably benign 0.00
R3841:BC035947 UTSW 1 78497845 missense probably benign 0.00
R4804:BC035947 UTSW 1 78497876 missense probably damaging 1.00
R4909:BC035947 UTSW 1 78498029 missense probably damaging 0.99
R5139:BC035947 UTSW 1 78499247 missense possibly damaging 0.60
R5302:BC035947 UTSW 1 78511962 start codon destroyed probably null 0.00
R5669:BC035947 UTSW 1 78497913 missense probably damaging 0.98
R5686:BC035947 UTSW 1 78497930 missense probably benign 0.03
R5868:BC035947 UTSW 1 78498323 missense probably damaging 1.00
R5988:BC035947 UTSW 1 78499206 nonsense probably null
R6787:BC035947 UTSW 1 78498890 missense possibly damaging 0.64
R6854:BC035947 UTSW 1 78498488 missense probably damaging 1.00
R7079:BC035947 UTSW 1 78497915 missense probably damaging 1.00
R7168:BC035947 UTSW 1 78499593 missense probably benign 0.04
R7387:BC035947 UTSW 1 78498461 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCGGTCTATCAGATGAACAATGG -3'
(R):5'- TGAACACTGTCTGACCAGGC -3'

Sequencing Primer
(F):5'- TCAAATACGGGTGGAGGCCC -3'
(R):5'- TGTCTGACCAGGCAGACC -3'
Posted On2014-09-17