Mutagenetix > Incidental Mutation

Incidental Mutation 'R2079:Dpp10'

229313

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

040084-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2079 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123432992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 268 (M268K)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000112603
AA Change: M257K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: M257K

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112606
AA Change: M268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: M268K

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	A	T	13: 104,462,238	R862S	probably benign	Het
Aldoa	T	C	7: 126,796,904	D164G	probably null	Het
Ankle2	T	C	5: 110,244,505	V459A	probably damaging	Het
Atp11a	A	G	8: 12,857,902	Y482C	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Cfap65	G	A	1: 74,917,199	R1074C	probably benign	Het
Ciart	G	T	3: 95,879,038	H242N	probably damaging	Het
Cidec	T	A	6: 113,425,654	M220L	probably benign	Het
Clca1	A	G	3: 145,007,773	I699T	possibly damaging	Het
Csf2rb2	T	C	15: 78,288,007	D401G	probably benign	Het
Cyp2j6	C	A	4: 96,531,725	L256F	possibly damaging	Het
Ddr2	A	T	1: 170,004,776	Y148*	probably null	Het
Depdc5	T	A	5: 32,946,674	I373N	possibly damaging	Het
Fam118b	C	A	9: 35,223,664	V216F	possibly damaging	Het
Fam71b	T	G	11: 46,405,107	V102G	probably benign	Het
Fancd2	T	C	6: 113,555,187	V487A	probably damaging	Het
Fhad1	T	A	4: 141,991,202	R147*	probably null	Het
Flt3	A	G	5: 147,355,083	S544P	probably damaging	Het
Frem3	C	A	8: 80,615,103	Q1342K	probably benign	Het
Gimap4	T	C	6: 48,690,947	M84T	possibly damaging	Het
Gm20481	T	C	17: 34,970,220	K569R	probably benign	Het
Gm4871	A	C	5: 145,029,931	D247E	possibly damaging	Het
Gm5141	A	T	13: 62,774,610	N248K	probably benign	Het
Gulo	A	G	14: 65,990,383	Y367H	probably damaging	Het
Hap1	T	C	11: 100,353,746	E120G	probably damaging	Het
Heatr3	T	A	8: 88,141,776	N51K	probably damaging	Het
Hipk2	T	C	6: 38,818,785	D183G	probably damaging	Het
Hnrnpll	T	A	17: 80,035,377	T439S	probably benign	Het
Hoxd3	A	C	2: 74,744,266	E85D	probably damaging	Het
Ipo8	A	T	6: 148,789,162	M694K	probably damaging	Het
Jag2	A	G	12: 112,920,377	I194T	probably damaging	Het
Jrkl	A	T	9: 13,244,859	F266I	probably damaging	Het
Kcnt1	A	G	2: 25,900,248	I436V	possibly damaging	Het
Kdm3b	A	T	18: 34,803,517	D284V	probably damaging	Het
Khdrbs2	A	G	1: 32,467,874	T200A	probably benign	Het
Kmt2c	T	C	5: 25,352,280	D1143G	possibly damaging	Het
Kremen1	G	GGGGT	11: 5,201,794		probably null	Het
Lama2	A	C	10: 27,369,053	I244S	probably damaging	Het
Lama5	G	A	2: 180,225,508	P99S	possibly damaging	Het
Lrrc30	A	T	17: 67,631,880	L235Q	possibly damaging	Het
Man2b2	C	T	5: 36,814,372	V667M	possibly damaging	Het
Mmp2	T	A	8: 92,850,189	N77K	probably damaging	Het
Myo1a	A	G	10: 127,720,613	E1009G	probably benign	Het
Ndst1	A	G	18: 60,695,509	Y658H	probably damaging	Het
Nlrp10	A	G	7: 108,925,628	L215P	possibly damaging	Het
Nrbp1	T	C	5: 31,251,073	F526L	probably benign	Het
Olfr574	T	A	7: 102,949,495	F333L	probably benign	Het
Olfr763	T	C	10: 129,012,029	V248A	probably damaging	Het
Padi2	T	C	4: 140,933,196	L329P	probably damaging	Het
Pcdhb20	A	G	18: 37,505,171	Q250R	probably benign	Het
Pcdhb3	T	A	18: 37,303,309	L776Q	possibly damaging	Het
Pik3cb	A	T	9: 99,060,204	M700K	probably benign	Het
Pla2g6	C	T	15: 79,312,994	V127M	probably damaging	Het
Rabgef1	T	C	5: 130,190,935	S80P	probably damaging	Het
Sema3a	C	T	5: 13,451,131	T47I	possibly damaging	Het
Sik2	C	T	9: 50,907,406		probably null	Het
Sin3a	T	C	9: 57,089,523	V112A	probably benign	Het
Slc26a6	G	A	9: 108,859,058	A472T	probably damaging	Het
Syne1	A	G	10: 5,361,502	V561A	probably benign	Het
Syt16	C	T	12: 74,238,299	T422I	probably damaging	Het
Tlr11	A	T	14: 50,360,980	H141L	probably damaging	Het
Tmem252	A	T	19: 24,677,653	E131D	probably benign	Het
Trim55	T	G	3: 19,644,666	L20V	probably damaging	Het
Uqcrfs1	A	T	13: 30,541,308	V83D	probably benign	Het
Utf1	C	T	7: 139,944,895	R309*	probably null	Het
Uxs1	T	C	1: 43,764,973	T261A	probably damaging	Het
Vmn1r24	T	C	6: 57,955,670	I288V	probably benign	Het
Vmn1r80	A	T	7: 12,193,194	D77V	probably damaging	Het
Vmn2r74	T	G	7: 85,957,175	H321P	probably benign	Het
Zfp638	T	C	6: 83,953,389		probably null	Het
Zwilch	T	A	9: 64,153,574	Q332L	probably damaging	Het
Zwilch	G	T	9: 64,153,575	Q332K	probably damaging	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
R9068:Dpp10	UTSW	1	123432938	missense	probably damaging	1.00
R9104:Dpp10	UTSW	1	123411755	missense	probably damaging	1.00
R9477:Dpp10	UTSW	1	123376641	missense	possibly damaging	0.46
R9492:Dpp10	UTSW	1	123353430	missense	probably damaging	1.00
R9524:Dpp10	UTSW	1	123336882	missense	probably damaging	1.00
R9576:Dpp10	UTSW	1	123341680	missense	probably damaging	1.00
R9631:Dpp10	UTSW	1	123341703	missense	probably damaging	1.00
R9736:Dpp10	UTSW	1	123334359	missense	possibly damaging	0.64
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACTCTACCTTGATTTCAGCTGACAAG -3'
(R):5'- TGCACAATGAGGATTTCAAGGAC -3'

Sequencing Primer
(F):5'- GCTGACAAGCTTAGAATTGATGG -3'
(R):5'- CAAGGACAGATGTTTGTGGGTCAC -3'

Posted On

2014-09-17