Incidental Mutation 'R2079:Dpp10'
ID 229313
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2079 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123432992 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 268 (M268K)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: M257K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: M257K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: M268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: M268K

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCTACCTTGATTTCAGCTGACAAG -3'
(R):5'- TGCACAATGAGGATTTCAAGGAC -3'

Sequencing Primer
(F):5'- GCTGACAAGCTTAGAATTGATGG -3'
(R):5'- CAAGGACAGATGTTTGTGGGTCAC -3'
Posted On 2014-09-17