Incidental Mutation 'R2079:Cyp2j6'
ID229322
Institutional Source Beutler Lab
Gene Symbol Cyp2j6
Ensembl Gene ENSMUSG00000052914
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 6
Synonyms
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96516138-96553661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96531725 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 256 (L256F)
Ref Sequence ENSEMBL: ENSMUSP00000030303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030303
AA Change: L256F

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030303
Gene: ENSMUSG00000052914
AA Change: L256F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 497 6.6e-138 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Cyp2j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Cyp2j6 APN 4 96536046 missense possibly damaging 0.78
IGL01543:Cyp2j6 APN 4 96525924 missense possibly damaging 0.78
IGL02324:Cyp2j6 APN 4 96525933 missense probably damaging 0.99
IGL02727:Cyp2j6 APN 4 96545764 missense probably benign
IGL02963:Cyp2j6 APN 4 96518184 missense probably damaging 1.00
IGL03099:Cyp2j6 APN 4 96536091 missense possibly damaging 0.65
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0376:Cyp2j6 UTSW 4 96526023 missense probably damaging 0.99
R0448:Cyp2j6 UTSW 4 96545728 missense probably benign
R0471:Cyp2j6 UTSW 4 96531748 nonsense probably null
R0734:Cyp2j6 UTSW 4 96523844 splice site probably benign
R1497:Cyp2j6 UTSW 4 96531661 missense probably damaging 1.00
R1686:Cyp2j6 UTSW 4 96523777 missense probably benign 0.08
R2293:Cyp2j6 UTSW 4 96529433 missense possibly damaging 0.87
R2350:Cyp2j6 UTSW 4 96529408 missense probably damaging 1.00
R2971:Cyp2j6 UTSW 4 96531781 missense probably benign 0.06
R3927:Cyp2j6 UTSW 4 96553288 missense probably benign 0.15
R4020:Cyp2j6 UTSW 4 96518170 missense probably benign 0.03
R5087:Cyp2j6 UTSW 4 96531699 missense probably damaging 0.99
R5309:Cyp2j6 UTSW 4 96535556 missense probably damaging 1.00
R5861:Cyp2j6 UTSW 4 96545803 missense possibly damaging 0.81
R5882:Cyp2j6 UTSW 4 96535602 missense probably benign 0.00
R6123:Cyp2j6 UTSW 4 96518029 makesense probably null
R6180:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6181:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6182:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6185:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6186:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6217:Cyp2j6 UTSW 4 96518161 missense probably damaging 1.00
R6784:Cyp2j6 UTSW 4 96535504 missense possibly damaging 0.70
R7038:Cyp2j6 UTSW 4 96535471 missense probably benign
R7146:Cyp2j6 UTSW 4 96545782 missense probably damaging 1.00
R7379:Cyp2j6 UTSW 4 96525946 missense probably damaging 0.99
R7470:Cyp2j6 UTSW 4 96535471 missense probably benign
R7536:Cyp2j6 UTSW 4 96535537 missense probably damaging 1.00
R7789:Cyp2j6 UTSW 4 96545716 missense probably benign 0.00
R8321:Cyp2j6 UTSW 4 96553447 missense probably benign 0.07
Z1176:Cyp2j6 UTSW 4 96536068 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAACCCTAAGTGTGTGGTGTG -3'
(R):5'- CTAAAGCTGGTCCCACAGTTTC -3'

Sequencing Primer
(F):5'- TGTGGTAGCCAGATGCATG -3'
(R):5'- TGGTCCCACAGTTTCACAGTAAG -3'
Posted On2014-09-17