Incidental Mutation 'R2079:Fancd2'
ID229344
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2079 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113555187 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 487 (V487A)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: V487A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: V487A

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123738
AA Change: V88A
SMART Domains Protein: ENSMUSP00000122091
Gene: ENSMUSG00000034023
AA Change: V88A

DomainStartEndE-ValueType
Pfam:FancD2 1 246 5.7e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142453
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: V487A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: V487A

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gm5141 A T 13: 62,774,610 N248K probably benign Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113563168 critical splice donor site probably null
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGTGTGTGGCAGCTAATAG -3'
(R):5'- GTGCTGCAGCTTTCCATCAC -3'

Sequencing Primer
(F):5'- TGTGTGGCAGCTAATAGACAGTAAG -3'
(R):5'- CTCTCACATTTATAGTGCTCAACAG -3'
Posted On2014-09-17