Incidental Mutation 'R0157:Bptf'
ID 22935
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms Falz, 9430093H17Rik
MMRRC Submission 038437-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0157 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 106923907-107022953 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106965484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1122 (T1122A)
Ref Sequence ENSEMBL: ENSMUSP00000052303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057892
AA Change: T1122A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T1122A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106762
AA Change: T1174A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T1174A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106763
AA Change: T1237A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T1237A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,056,527 (GRCm39) I180N probably damaging Het
Alk T A 17: 72,256,840 (GRCm39) N673I probably benign Het
Ankrd7 T C 6: 18,866,539 (GRCm39) S20P probably damaging Het
Arhgef26 T G 3: 62,288,392 (GRCm39) D487E probably damaging Het
Arhgef4 A G 1: 34,845,475 (GRCm39) D1500G probably damaging Het
Arhgef7 A G 8: 11,835,812 (GRCm39) I39V probably damaging Het
Asap2 T A 12: 21,256,326 (GRCm39) I208N probably damaging Het
Atad5 T C 11: 79,980,643 (GRCm39) V16A possibly damaging Het
Atp2b1 T C 10: 98,835,809 (GRCm39) I518T probably damaging Het
B130006D01Rik T C 11: 95,617,211 (GRCm39) probably benign Het
BC028528 A G 3: 95,792,280 (GRCm39) probably null Het
Bpifb6 T A 2: 153,745,886 (GRCm39) L74Q probably benign Het
Cacna2d4 T A 6: 119,289,385 (GRCm39) D806E probably benign Het
Cdhr3 T C 12: 33,111,649 (GRCm39) Q287R possibly damaging Het
Cdk12 A G 11: 98,140,602 (GRCm39) probably benign Het
Cenpf T A 1: 189,384,556 (GRCm39) T2575S probably benign Het
Chd7 T A 4: 8,833,759 (GRCm39) I1171N probably damaging Het
Chd9 T C 8: 91,735,464 (GRCm39) probably null Het
Ckmt1 A G 2: 121,193,522 (GRCm39) T361A possibly damaging Het
Clec4d G T 6: 123,244,095 (GRCm39) R68L probably benign Het
Csmd2 G T 4: 128,415,704 (GRCm39) V2678F probably benign Het
Cul7 T A 17: 46,964,761 (GRCm39) V131E possibly damaging Het
Dab2 T C 15: 6,459,308 (GRCm39) S407P probably benign Het
Dnah17 C T 11: 118,017,997 (GRCm39) G166D probably benign Het
F13b G A 1: 139,431,585 (GRCm39) V52I probably benign Het
Gjd4 T C 18: 9,280,549 (GRCm39) I176M probably benign Het
Hoxc11 A G 15: 102,863,436 (GRCm39) Y159C probably damaging Het
Hydin T C 8: 111,026,642 (GRCm39) I120T possibly damaging Het
Il20rb A G 9: 100,355,132 (GRCm39) Y104H probably damaging Het
Krtap21-1 A G 16: 89,200,430 (GRCm39) C71R unknown Het
Lamc1 T C 1: 153,138,353 (GRCm39) D167G probably benign Het
Lin7c C A 2: 109,725,514 (GRCm39) A73E probably damaging Het
Meiosin T C 7: 18,840,945 (GRCm39) H63R possibly damaging Het
Mms22l C A 4: 24,588,224 (GRCm39) A952E probably damaging Het
Myh3 A G 11: 66,973,735 (GRCm39) N136S probably benign Het
Ndufb10 T C 17: 24,943,218 (GRCm39) T31A probably benign Het
Nlrp2 T C 7: 5,311,769 (GRCm39) Y37C possibly damaging Het
Or2t44 T C 11: 58,677,885 (GRCm39) F275S probably damaging Het
Or2y14 T C 11: 49,404,600 (GRCm39) I45T probably damaging Het
Orc3 C A 4: 34,607,130 (GRCm39) probably null Het
Pard3b A C 1: 62,250,792 (GRCm39) M512L probably damaging Het
Pcdh10 A G 3: 45,334,136 (GRCm39) D150G probably damaging Het
Pcolce A T 5: 137,608,741 (GRCm39) probably null Het
Pdcl A C 2: 37,242,189 (GRCm39) I187S probably damaging Het
Pkn1 T C 8: 84,419,449 (GRCm39) I51M probably damaging Het
Pla2g4e T A 2: 120,000,662 (GRCm39) T692S probably benign Het
Plcb2 C A 2: 118,549,022 (GRCm39) V380F probably damaging Het
Pmpcb A T 5: 21,947,950 (GRCm39) I218F probably damaging Het
Pms1 A T 1: 53,234,196 (GRCm39) Y773* probably null Het
Polr2e C T 10: 79,872,615 (GRCm39) G184R probably damaging Het
Polr3a T C 14: 24,529,254 (GRCm39) I369V probably damaging Het
Pramel21 C T 4: 143,342,366 (GRCm39) P158S probably damaging Het
Prpf4b T C 13: 35,068,014 (GRCm39) probably benign Het
Pzp G A 6: 128,500,939 (GRCm39) Q140* probably null Het
Qrich2 T A 11: 116,332,221 (GRCm39) E2325V probably damaging Het
R3hdm2 T G 10: 127,307,858 (GRCm39) L373R probably damaging Het
Sema3d A T 5: 12,558,104 (GRCm39) D212V possibly damaging Het
Sidt2 A G 9: 45,850,565 (GRCm39) I850T probably damaging Het
Slc22a29 C T 19: 8,140,106 (GRCm39) R433H possibly damaging Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Sox21 G A 14: 118,473,354 (GRCm39) probably benign Het
Steap3 A G 1: 120,155,379 (GRCm39) *527R probably null Het
Svep1 T C 4: 58,069,830 (GRCm39) E2652G possibly damaging Het
Taar2 T A 10: 23,817,389 (GRCm39) F310I probably damaging Het
Tasor2 C A 13: 3,625,550 (GRCm39) V1467L probably benign Het
Tecta A G 9: 42,286,307 (GRCm39) V783A probably benign Het
Vmn1r173 T A 7: 23,401,822 (GRCm39) I19N probably damaging Het
Vwa5b1 T A 4: 138,332,190 (GRCm39) M276L probably benign Het
Yeats2 A C 16: 20,040,427 (GRCm39) *142C probably null Het
Zfp26 G T 9: 20,349,166 (GRCm39) T466K probably benign Het
Zfp426 T C 9: 20,382,432 (GRCm39) N171S probably benign Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 106,946,105 (GRCm39) missense possibly damaging 0.88
IGL00664:Bptf APN 11 106,968,491 (GRCm39) missense possibly damaging 0.78
IGL00705:Bptf APN 11 106,986,534 (GRCm39) splice site probably benign
IGL00796:Bptf APN 11 106,945,376 (GRCm39) missense probably damaging 1.00
IGL00834:Bptf APN 11 106,964,754 (GRCm39) missense possibly damaging 0.59
IGL01155:Bptf APN 11 106,971,553 (GRCm39) missense probably damaging 1.00
IGL01314:Bptf APN 11 106,945,679 (GRCm39) missense probably damaging 1.00
IGL01371:Bptf APN 11 106,946,733 (GRCm39) missense probably benign 0.00
IGL01567:Bptf APN 11 106,949,600 (GRCm39) missense probably damaging 1.00
IGL01794:Bptf APN 11 106,944,047 (GRCm39) critical splice donor site probably null
IGL02108:Bptf APN 11 106,965,814 (GRCm39) missense probably benign 0.45
IGL02367:Bptf APN 11 106,964,178 (GRCm39) missense probably benign
IGL02437:Bptf APN 11 106,965,521 (GRCm39) missense probably benign 0.00
IGL02589:Bptf APN 11 107,002,357 (GRCm39) missense possibly damaging 0.92
IGL02897:Bptf APN 11 106,937,947 (GRCm39) missense probably damaging 1.00
IGL02935:Bptf APN 11 106,971,625 (GRCm39) missense probably damaging 1.00
IGL02954:Bptf APN 11 106,945,575 (GRCm39) missense possibly damaging 0.89
IGL02982:Bptf APN 11 106,967,500 (GRCm39) missense probably damaging 1.00
IGL03109:Bptf APN 11 106,952,527 (GRCm39) missense possibly damaging 0.53
IGL03265:Bptf APN 11 106,945,454 (GRCm39) missense probably benign 0.00
IGL03403:Bptf APN 11 106,990,559 (GRCm39) missense possibly damaging 0.51
Anodyne UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
Arroyo UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
mojado UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
IGL03097:Bptf UTSW 11 106,968,506 (GRCm39) missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 106,945,614 (GRCm39) missense probably damaging 0.98
R0066:Bptf UTSW 11 106,952,962 (GRCm39) missense possibly damaging 0.90
R0320:Bptf UTSW 11 106,963,645 (GRCm39) missense probably damaging 1.00
R0328:Bptf UTSW 11 106,937,953 (GRCm39) missense probably damaging 1.00
R0402:Bptf UTSW 11 106,964,940 (GRCm39) missense probably damaging 1.00
R0482:Bptf UTSW 11 106,972,088 (GRCm39) missense probably benign 0.13
R0574:Bptf UTSW 11 106,967,353 (GRCm39) missense probably damaging 1.00
R0598:Bptf UTSW 11 106,963,791 (GRCm39) missense probably damaging 0.99
R0599:Bptf UTSW 11 106,959,208 (GRCm39) missense probably damaging 1.00
R0601:Bptf UTSW 11 106,952,518 (GRCm39) missense probably benign 0.04
R0744:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0836:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0885:Bptf UTSW 11 106,934,617 (GRCm39) missense probably damaging 1.00
R1070:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1252:Bptf UTSW 11 106,964,077 (GRCm39) missense probably benign 0.00
R1370:Bptf UTSW 11 106,937,920 (GRCm39) missense probably damaging 0.99
R1428:Bptf UTSW 11 106,963,873 (GRCm39) missense probably damaging 0.99
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1742:Bptf UTSW 11 107,001,777 (GRCm39) missense probably damaging 1.00
R1816:Bptf UTSW 11 106,951,405 (GRCm39) missense probably damaging 1.00
R1858:Bptf UTSW 11 106,964,127 (GRCm39) missense probably benign 0.00
R1989:Bptf UTSW 11 106,965,652 (GRCm39) missense probably damaging 1.00
R2253:Bptf UTSW 11 107,002,148 (GRCm39) missense probably damaging 1.00
R2392:Bptf UTSW 11 106,963,573 (GRCm39) missense probably damaging 1.00
R2431:Bptf UTSW 11 106,938,066 (GRCm39) missense possibly damaging 0.48
R3022:Bptf UTSW 11 107,002,463 (GRCm39) critical splice acceptor site probably null
R3161:Bptf UTSW 11 106,965,302 (GRCm39) missense probably damaging 1.00
R3686:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3687:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3688:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3787:Bptf UTSW 11 106,964,653 (GRCm39) missense probably damaging 1.00
R3834:Bptf UTSW 11 106,964,683 (GRCm39) missense probably benign 0.05
R3885:Bptf UTSW 11 106,965,339 (GRCm39) missense probably damaging 0.97
R4090:Bptf UTSW 11 106,972,349 (GRCm39) missense probably damaging 0.99
R4398:Bptf UTSW 11 107,001,670 (GRCm39) missense probably damaging 1.00
R4437:Bptf UTSW 11 106,965,300 (GRCm39) missense possibly damaging 0.59
R4514:Bptf UTSW 11 106,968,518 (GRCm39) missense probably damaging 1.00
R4565:Bptf UTSW 11 106,963,836 (GRCm39) missense probably damaging 1.00
R4715:Bptf UTSW 11 106,938,007 (GRCm39) missense probably damaging 1.00
R4748:Bptf UTSW 11 106,986,706 (GRCm39) missense probably damaging 0.96
R4764:Bptf UTSW 11 106,934,520 (GRCm39) missense probably damaging 1.00
R4885:Bptf UTSW 11 106,965,474 (GRCm39) missense probably benign 0.39
R4901:Bptf UTSW 11 107,001,686 (GRCm39) nonsense probably null
R4995:Bptf UTSW 11 106,945,391 (GRCm39) missense probably damaging 0.98
R5057:Bptf UTSW 11 106,973,354 (GRCm39) missense probably damaging 0.98
R5120:Bptf UTSW 11 106,964,211 (GRCm39) missense probably damaging 0.99
R5320:Bptf UTSW 11 106,972,193 (GRCm39) nonsense probably null
R5329:Bptf UTSW 11 106,964,121 (GRCm39) missense probably benign 0.06
R5418:Bptf UTSW 11 107,002,120 (GRCm39) missense probably damaging 1.00
R5461:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R5664:Bptf UTSW 11 106,964,525 (GRCm39) missense probably benign 0.01
R5718:Bptf UTSW 11 107,002,260 (GRCm39) missense probably damaging 1.00
R5774:Bptf UTSW 11 107,001,963 (GRCm39) missense probably damaging 1.00
R5851:Bptf UTSW 11 107,001,688 (GRCm39) missense probably damaging 1.00
R5930:Bptf UTSW 11 106,964,022 (GRCm39) missense probably damaging 1.00
R5949:Bptf UTSW 11 107,001,915 (GRCm39) missense probably damaging 0.99
R5975:Bptf UTSW 11 106,926,690 (GRCm39) utr 3 prime probably benign
R6027:Bptf UTSW 11 106,965,771 (GRCm39) missense probably damaging 1.00
R6128:Bptf UTSW 11 106,965,516 (GRCm39) missense possibly damaging 0.87
R6337:Bptf UTSW 11 106,949,605 (GRCm39) missense possibly damaging 0.89
R6407:Bptf UTSW 11 107,001,952 (GRCm39) missense probably damaging 1.00
R6470:Bptf UTSW 11 106,963,593 (GRCm39) missense probably damaging 1.00
R6487:Bptf UTSW 11 106,968,552 (GRCm39) missense probably damaging 0.99
R6501:Bptf UTSW 11 106,968,509 (GRCm39) missense probably null 1.00
R6755:Bptf UTSW 11 106,938,082 (GRCm39) missense probably benign 0.27
R6861:Bptf UTSW 11 106,953,391 (GRCm39) missense probably damaging 1.00
R6866:Bptf UTSW 11 106,964,406 (GRCm39) missense probably damaging 1.00
R6879:Bptf UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
R6927:Bptf UTSW 11 106,945,421 (GRCm39) missense probably damaging 1.00
R6944:Bptf UTSW 11 106,971,649 (GRCm39) missense probably damaging 1.00
R7082:Bptf UTSW 11 106,977,573 (GRCm39) missense probably benign 0.00
R7136:Bptf UTSW 11 106,990,541 (GRCm39) missense probably damaging 1.00
R7162:Bptf UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
R7171:Bptf UTSW 11 107,022,233 (GRCm39) missense unknown
R7193:Bptf UTSW 11 106,945,635 (GRCm39) nonsense probably null
R7210:Bptf UTSW 11 106,945,290 (GRCm39) nonsense probably null
R7221:Bptf UTSW 11 106,945,658 (GRCm39) missense probably damaging 1.00
R7316:Bptf UTSW 11 107,001,740 (GRCm39) nonsense probably null
R7316:Bptf UTSW 11 106,963,935 (GRCm39) missense probably damaging 1.00
R7422:Bptf UTSW 11 106,951,384 (GRCm39) missense probably damaging 1.00
R7454:Bptf UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
R7657:Bptf UTSW 11 106,965,555 (GRCm39) missense probably damaging 1.00
R7718:Bptf UTSW 11 106,972,282 (GRCm39) missense possibly damaging 0.65
R7827:Bptf UTSW 11 106,938,013 (GRCm39) missense probably benign 0.01
R7844:Bptf UTSW 11 106,964,887 (GRCm39) missense probably damaging 0.97
R7992:Bptf UTSW 11 107,001,709 (GRCm39) missense probably benign 0.00
R8001:Bptf UTSW 11 106,938,166 (GRCm39) nonsense probably null
R8037:Bptf UTSW 11 106,946,776 (GRCm39) missense probably damaging 1.00
R8122:Bptf UTSW 11 106,927,417 (GRCm39) critical splice acceptor site probably null
R8235:Bptf UTSW 11 106,967,458 (GRCm39) missense probably benign 0.04
R8308:Bptf UTSW 11 106,943,815 (GRCm39) missense probably damaging 0.99
R8409:Bptf UTSW 11 106,953,495 (GRCm39) missense probably damaging 1.00
R8464:Bptf UTSW 11 107,022,168 (GRCm39) missense probably benign 0.01
R8477:Bptf UTSW 11 106,943,679 (GRCm39) missense probably damaging 0.98
R8482:Bptf UTSW 11 106,934,524 (GRCm39) missense probably benign 0.19
R8515:Bptf UTSW 11 106,946,064 (GRCm39) missense possibly damaging 0.85
R8519:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,140 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,139 (GRCm39) missense probably damaging 0.99
R8722:Bptf UTSW 11 107,022,295 (GRCm39) missense unknown
R8732:Bptf UTSW 11 106,931,206 (GRCm39) missense probably damaging 1.00
R8783:Bptf UTSW 11 107,022,357 (GRCm39) missense unknown
R8828:Bptf UTSW 11 106,945,836 (GRCm39) missense probably damaging 0.98
R9004:Bptf UTSW 11 106,945,713 (GRCm39) missense probably damaging 1.00
R9010:Bptf UTSW 11 106,964,576 (GRCm39) missense probably damaging 1.00
R9035:Bptf UTSW 11 106,963,842 (GRCm39) missense probably damaging 1.00
R9083:Bptf UTSW 11 106,959,176 (GRCm39) missense probably damaging 1.00
R9211:Bptf UTSW 11 106,946,124 (GRCm39) missense probably damaging 1.00
R9345:Bptf UTSW 11 106,971,588 (GRCm39) missense possibly damaging 0.77
R9393:Bptf UTSW 11 106,965,134 (GRCm39) missense probably benign 0.00
R9451:Bptf UTSW 11 106,935,411 (GRCm39) missense probably damaging 1.00
R9561:Bptf UTSW 11 106,964,954 (GRCm39) nonsense probably null
R9632:Bptf UTSW 11 106,952,545 (GRCm39) missense probably damaging 1.00
R9648:Bptf UTSW 11 106,943,720 (GRCm39) missense probably damaging 0.99
R9650:Bptf UTSW 11 106,935,412 (GRCm39) missense probably benign 0.15
R9658:Bptf UTSW 11 107,002,170 (GRCm39) missense probably damaging 1.00
R9775:Bptf UTSW 11 106,934,502 (GRCm39) missense probably benign 0.04
R9776:Bptf UTSW 11 106,969,396 (GRCm39) missense probably damaging 1.00
Z1088:Bptf UTSW 11 106,965,408 (GRCm39) missense probably benign 0.00
Z1176:Bptf UTSW 11 106,949,510 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCGCTTTCAACTGAGTTTTGCC -3'
(R):5'- ACGAAATCCTCTAAGCTGGACGGG -3'

Sequencing Primer
(F):5'- CTGGACTCTGAATGGAGACATCATC -3'
(R):5'- CTAAGCTGGACGGGCTTCTG -3'
Posted On 2013-04-16