Mutagenetix > Incidental Mutation

Incidental Mutation 'R2079:Pik3cb'

229363

Institutional Source

Beutler Lab

Gene Symbol

Pik3cb

Ensembl Gene

ENSMUSG00000032462

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta

Synonyms

p110beta, 1110001J02Rik

MMRRC Submission

040084-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R2079 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99036654-99140621 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99060204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 700 (M700K)

Ref Sequence

ENSEMBL: ENSMUSP00000035037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]

AlphaFold

Q8BTI9

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000035037
AA Change: M700K

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: M700K

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
PI3Ka	519	705	1.08e-92	SMART
PI3Kc	795	1061	8.75e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136965

SMART Domains

Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
Blast:PI3Ka	450	520	1e-37	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	A	T	13: 104,462,238	R862S	probably benign	Het
Aldoa	T	C	7: 126,796,904	D164G	probably null	Het
Ankle2	T	C	5: 110,244,505	V459A	probably damaging	Het
Atp11a	A	G	8: 12,857,902	Y482C	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Cfap65	G	A	1: 74,917,199	R1074C	probably benign	Het
Ciart	G	T	3: 95,879,038	H242N	probably damaging	Het
Cidec	T	A	6: 113,425,654	M220L	probably benign	Het
Clca1	A	G	3: 145,007,773	I699T	possibly damaging	Het
Csf2rb2	T	C	15: 78,288,007	D401G	probably benign	Het
Cyp2j6	C	A	4: 96,531,725	L256F	possibly damaging	Het
Ddr2	A	T	1: 170,004,776	Y148*	probably null	Het
Depdc5	T	A	5: 32,946,674	I373N	possibly damaging	Het
Dpp10	A	T	1: 123,432,992	M268K	probably damaging	Het
Fam118b	C	A	9: 35,223,664	V216F	possibly damaging	Het
Fam71b	T	G	11: 46,405,107	V102G	probably benign	Het
Fancd2	T	C	6: 113,555,187	V487A	probably damaging	Het
Fhad1	T	A	4: 141,991,202	R147*	probably null	Het
Flt3	A	G	5: 147,355,083	S544P	probably damaging	Het
Frem3	C	A	8: 80,615,103	Q1342K	probably benign	Het
Gimap4	T	C	6: 48,690,947	M84T	possibly damaging	Het
Gm20481	T	C	17: 34,970,220	K569R	probably benign	Het
Gm4871	A	C	5: 145,029,931	D247E	possibly damaging	Het
Gm5141	A	T	13: 62,774,610	N248K	probably benign	Het
Gulo	A	G	14: 65,990,383	Y367H	probably damaging	Het
Hap1	T	C	11: 100,353,746	E120G	probably damaging	Het
Heatr3	T	A	8: 88,141,776	N51K	probably damaging	Het
Hipk2	T	C	6: 38,818,785	D183G	probably damaging	Het
Hnrnpll	T	A	17: 80,035,377	T439S	probably benign	Het
Hoxd3	A	C	2: 74,744,266	E85D	probably damaging	Het
Ipo8	A	T	6: 148,789,162	M694K	probably damaging	Het
Jag2	A	G	12: 112,920,377	I194T	probably damaging	Het
Jrkl	A	T	9: 13,244,859	F266I	probably damaging	Het
Kcnt1	A	G	2: 25,900,248	I436V	possibly damaging	Het
Kdm3b	A	T	18: 34,803,517	D284V	probably damaging	Het
Khdrbs2	A	G	1: 32,467,874	T200A	probably benign	Het
Kmt2c	T	C	5: 25,352,280	D1143G	possibly damaging	Het
Kremen1	G	GGGGT	11: 5,201,794		probably null	Het
Lama2	A	C	10: 27,369,053	I244S	probably damaging	Het
Lama5	G	A	2: 180,225,508	P99S	possibly damaging	Het
Lrrc30	A	T	17: 67,631,880	L235Q	possibly damaging	Het
Man2b2	C	T	5: 36,814,372	V667M	possibly damaging	Het
Mmp2	T	A	8: 92,850,189	N77K	probably damaging	Het
Myo1a	A	G	10: 127,720,613	E1009G	probably benign	Het
Ndst1	A	G	18: 60,695,509	Y658H	probably damaging	Het
Nlrp10	A	G	7: 108,925,628	L215P	possibly damaging	Het
Nrbp1	T	C	5: 31,251,073	F526L	probably benign	Het
Olfr574	T	A	7: 102,949,495	F333L	probably benign	Het
Olfr763	T	C	10: 129,012,029	V248A	probably damaging	Het
Padi2	T	C	4: 140,933,196	L329P	probably damaging	Het
Pcdhb20	A	G	18: 37,505,171	Q250R	probably benign	Het
Pcdhb3	T	A	18: 37,303,309	L776Q	possibly damaging	Het
Pla2g6	C	T	15: 79,312,994	V127M	probably damaging	Het
Rabgef1	T	C	5: 130,190,935	S80P	probably damaging	Het
Sema3a	C	T	5: 13,451,131	T47I	possibly damaging	Het
Sik2	C	T	9: 50,907,406		probably null	Het
Sin3a	T	C	9: 57,089,523	V112A	probably benign	Het
Slc26a6	G	A	9: 108,859,058	A472T	probably damaging	Het
Syne1	A	G	10: 5,361,502	V561A	probably benign	Het
Syt16	C	T	12: 74,238,299	T422I	probably damaging	Het
Tlr11	A	T	14: 50,360,980	H141L	probably damaging	Het
Tmem252	A	T	19: 24,677,653	E131D	probably benign	Het
Trim55	T	G	3: 19,644,666	L20V	probably damaging	Het
Uqcrfs1	A	T	13: 30,541,308	V83D	probably benign	Het
Utf1	C	T	7: 139,944,895	R309*	probably null	Het
Uxs1	T	C	1: 43,764,973	T261A	probably damaging	Het
Vmn1r24	T	C	6: 57,955,670	I288V	probably benign	Het
Vmn1r80	A	T	7: 12,193,194	D77V	probably damaging	Het
Vmn2r74	T	G	7: 85,957,175	H321P	probably benign	Het
Zfp638	T	C	6: 83,953,389		probably null	Het
Zwilch	T	A	9: 64,153,574	Q332L	probably damaging	Het
Zwilch	G	T	9: 64,153,575	Q332K	probably damaging	Het

Other mutations in Pik3cb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Pik3cb	APN	9	99101286	missense	probably damaging	0.96
IGL01354:Pik3cb	APN	9	99064168	missense	possibly damaging	0.83
IGL02132:Pik3cb	APN	9	99071377	missense	probably benign	0.01
IGL02268:Pik3cb	APN	9	99046556	missense	probably benign	0.00
IGL02376:Pik3cb	APN	9	99052352	missense	probably benign	0.00
IGL02378:Pik3cb	APN	9	99062840	missense	probably benign	0.40
IGL02748:Pik3cb	APN	9	99062968	splice site	probably benign
IGL03038:Pik3cb	APN	9	99065597	missense	probably damaging	1.00
IGL03142:Pik3cb	APN	9	99065562	missense	probably benign	0.10
H8786:Pik3cb	UTSW	9	99046559	missense	possibly damaging	0.80
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0305:Pik3cb	UTSW	9	99064076	missense	possibly damaging	0.86
R0464:Pik3cb	UTSW	9	99044743	critical splice donor site	probably null
R0635:Pik3cb	UTSW	9	99064218	splice site	probably benign
R1386:Pik3cb	UTSW	9	99064027	missense	possibly damaging	0.90
R1530:Pik3cb	UTSW	9	99053973	missense	probably damaging	0.96
R1802:Pik3cb	UTSW	9	99101289	nonsense	probably null
R1815:Pik3cb	UTSW	9	99093095	missense	possibly damaging	0.93
R2011:Pik3cb	UTSW	9	99105579	nonsense	probably null
R2153:Pik3cb	UTSW	9	99101244	nonsense	probably null
R2237:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2238:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2513:Pik3cb	UTSW	9	99061842	missense	probably damaging	1.00
R3982:Pik3cb	UTSW	9	99046601	missense	probably benign	0.06
R4009:Pik3cb	UTSW	9	99040929	missense	probably damaging	0.98
R4246:Pik3cb	UTSW	9	99101176	splice site	probably null
R4248:Pik3cb	UTSW	9	99101176	splice site	probably null
R4249:Pik3cb	UTSW	9	99101176	splice site	probably null
R4334:Pik3cb	UTSW	9	99061851	missense	probably damaging	1.00
R4544:Pik3cb	UTSW	9	99039759	missense	probably damaging	1.00
R4568:Pik3cb	UTSW	9	99090302	missense	probably benign	0.00
R4571:Pik3cb	UTSW	9	99090257	missense	possibly damaging	0.94
R4595:Pik3cb	UTSW	9	99055406	missense	possibly damaging	0.95
R4599:Pik3cb	UTSW	9	99061764	missense	probably benign	0.15
R4820:Pik3cb	UTSW	9	99073626	missense	probably benign	0.00
R4887:Pik3cb	UTSW	9	99101328	missense	probably damaging	0.99
R4967:Pik3cb	UTSW	9	99105632	missense	probably benign	0.14
R5029:Pik3cb	UTSW	9	99054060	missense	probably damaging	0.98
R5031:Pik3cb	UTSW	9	99071408	missense	probably damaging	1.00
R5394:Pik3cb	UTSW	9	99088663	missense	probably benign
R5769:Pik3cb	UTSW	9	99093159	nonsense	probably null
R6128:Pik3cb	UTSW	9	99064099	missense	possibly damaging	0.95
R6250:Pik3cb	UTSW	9	99094598	missense	probably benign	0.01
R6354:Pik3cb	UTSW	9	99073643	missense	probably benign	0.00
R6370:Pik3cb	UTSW	9	99040934	missense	probably damaging	1.00
R6664:Pik3cb	UTSW	9	99094538	missense	possibly damaging	0.56
R6665:Pik3cb	UTSW	9	99073649	missense	probably benign	0.00
R6751:Pik3cb	UTSW	9	99094521	missense	probably benign
R6781:Pik3cb	UTSW	9	99040992	missense	possibly damaging	0.52
R6869:Pik3cb	UTSW	9	99060259	missense	probably benign	0.08
R6883:Pik3cb	UTSW	9	99101400	missense	probably benign	0.00
R7150:Pik3cb	UTSW	9	99093090	missense	probably damaging	1.00
R7446:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R7679:Pik3cb	UTSW	9	99088607	missense	probably benign	0.05
R7831:Pik3cb	UTSW	9	99088613	missense	probably benign
R8300:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R8837:Pik3cb	UTSW	9	99054064	missense	possibly damaging	0.65
R8911:Pik3cb	UTSW	9	99064148	missense	probably benign	0.40
R9299:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9337:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9477:Pik3cb	UTSW	9	99040920	critical splice donor site	probably null
R9641:Pik3cb	UTSW	9	99073736	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAGTCTGCCTCCTTCATGTC -3'
(R):5'- CAGAAGAGCATTCCATGGCAG -3'

Sequencing Primer
(F):5'- CATGGACCTCTCTGACTAAATGGTG -3'
(R):5'- CAGAATAAGGAGGTCAGTGCTTGTTC -3'

Posted On

2014-09-17