Incidental Mutation 'R2079:Jag2'
ID 229374
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms D12Ggc2e, Serh
MMRRC Submission 040084-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2079 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 112871439-112893396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112883997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 194 (I194T)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: I194T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: I194T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222402
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,598,746 (GRCm39) R862S probably benign Het
Aldoa T C 7: 126,396,076 (GRCm39) D164G probably null Het
Ankle2 T C 5: 110,392,371 (GRCm39) V459A probably damaging Het
Atp11a A G 8: 12,907,902 (GRCm39) Y482C probably damaging Het
BC035947 A G 1: 78,488,561 (GRCm39) probably benign Het
Cfap65 G A 1: 74,956,358 (GRCm39) R1074C probably benign Het
Ciart G T 3: 95,786,350 (GRCm39) H242N probably damaging Het
Cidec T A 6: 113,402,615 (GRCm39) M220L probably benign Het
Clca3a1 A G 3: 144,713,534 (GRCm39) I699T possibly damaging Het
Csf2rb2 T C 15: 78,172,207 (GRCm39) D401G probably benign Het
Cyp2j6 C A 4: 96,419,962 (GRCm39) L256F possibly damaging Het
Ddr2 A T 1: 169,832,345 (GRCm39) Y148* probably null Het
Depdc5 T A 5: 33,104,018 (GRCm39) I373N possibly damaging Het
Dpp10 A T 1: 123,360,721 (GRCm39) M268K probably damaging Het
Fam118b C A 9: 35,134,960 (GRCm39) V216F possibly damaging Het
Fancd2 T C 6: 113,532,148 (GRCm39) V487A probably damaging Het
Fhad1 T A 4: 141,718,513 (GRCm39) R147* probably null Het
Flt3 A G 5: 147,291,893 (GRCm39) S544P probably damaging Het
Frem3 C A 8: 81,341,732 (GRCm39) Q1342K probably benign Het
Garin3 T G 11: 46,295,934 (GRCm39) V102G probably benign Het
Gimap4 T C 6: 48,667,881 (GRCm39) M84T possibly damaging Het
Gm20481 T C 17: 35,189,196 (GRCm39) K569R probably benign Het
Gm4871 A C 5: 144,966,741 (GRCm39) D247E possibly damaging Het
Gm5141 A T 13: 62,922,424 (GRCm39) N248K probably benign Het
Gulo A G 14: 66,227,832 (GRCm39) Y367H probably damaging Het
Hap1 T C 11: 100,244,572 (GRCm39) E120G probably damaging Het
Heatr3 T A 8: 88,868,404 (GRCm39) N51K probably damaging Het
Hipk2 T C 6: 38,795,720 (GRCm39) D183G probably damaging Het
Hnrnpll T A 17: 80,342,806 (GRCm39) T439S probably benign Het
Hoxd3 A C 2: 74,574,610 (GRCm39) E85D probably damaging Het
Ipo8 A T 6: 148,690,660 (GRCm39) M694K probably damaging Het
Jrkl A T 9: 13,244,864 (GRCm39) F266I probably damaging Het
Kcnt1 A G 2: 25,790,260 (GRCm39) I436V possibly damaging Het
Kdm3b A T 18: 34,936,570 (GRCm39) D284V probably damaging Het
Khdrbs2 A G 1: 32,506,955 (GRCm39) T200A probably benign Het
Kmt2c T C 5: 25,557,278 (GRCm39) D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,151,794 (GRCm39) probably null Het
Lama2 A C 10: 27,245,049 (GRCm39) I244S probably damaging Het
Lama5 G A 2: 179,867,301 (GRCm39) P99S possibly damaging Het
Lrrc30 A T 17: 67,938,875 (GRCm39) L235Q possibly damaging Het
Man2b2 C T 5: 36,971,716 (GRCm39) V667M possibly damaging Het
Mmp2 T A 8: 93,576,817 (GRCm39) N77K probably damaging Het
Myo1a A G 10: 127,556,482 (GRCm39) E1009G probably benign Het
Ndst1 A G 18: 60,828,581 (GRCm39) Y658H probably damaging Het
Nlrp10 A G 7: 108,524,835 (GRCm39) L215P possibly damaging Het
Nrbp1 T C 5: 31,408,417 (GRCm39) F526L probably benign Het
Or10p21 T C 10: 128,847,898 (GRCm39) V248A probably damaging Het
Or51t4 T A 7: 102,598,702 (GRCm39) F333L probably benign Het
Padi2 T C 4: 140,660,507 (GRCm39) L329P probably damaging Het
Pcdhb20 A G 18: 37,638,224 (GRCm39) Q250R probably benign Het
Pcdhb3 T A 18: 37,436,362 (GRCm39) L776Q possibly damaging Het
Pik3cb A T 9: 98,942,257 (GRCm39) M700K probably benign Het
Pla2g6 C T 15: 79,197,194 (GRCm39) V127M probably damaging Het
Rabgef1 T C 5: 130,219,776 (GRCm39) S80P probably damaging Het
Sema3a C T 5: 13,501,098 (GRCm39) T47I possibly damaging Het
Sik2 C T 9: 50,818,706 (GRCm39) probably null Het
Sin3a T C 9: 56,996,807 (GRCm39) V112A probably benign Het
Slc26a6 G A 9: 108,736,257 (GRCm39) A472T probably damaging Het
Syne1 A G 10: 5,311,502 (GRCm39) V561A probably benign Het
Syt16 C T 12: 74,285,073 (GRCm39) T422I probably damaging Het
Tlr11 A T 14: 50,598,437 (GRCm39) H141L probably damaging Het
Tmem252 A T 19: 24,655,017 (GRCm39) E131D probably benign Het
Trim55 T G 3: 19,698,830 (GRCm39) L20V probably damaging Het
Uqcrfs1 A T 13: 30,725,291 (GRCm39) V83D probably benign Het
Utf1 C T 7: 139,524,808 (GRCm39) R309* probably null Het
Uxs1 T C 1: 43,804,133 (GRCm39) T261A probably damaging Het
Vmn1r24 T C 6: 57,932,655 (GRCm39) I288V probably benign Het
Vmn1r80 A T 7: 11,927,121 (GRCm39) D77V probably damaging Het
Vmn2r74 T G 7: 85,606,383 (GRCm39) H321P probably benign Het
Zfp638 T C 6: 83,930,371 (GRCm39) probably null Het
Zwilch T A 9: 64,060,856 (GRCm39) Q332L probably damaging Het
Zwilch G T 9: 64,060,857 (GRCm39) Q332K probably damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112,876,338 (GRCm39) missense probably benign 0.20
IGL00954:Jag2 APN 12 112,884,026 (GRCm39) missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112,877,983 (GRCm39) missense probably damaging 0.98
IGL01646:Jag2 APN 12 112,879,969 (GRCm39) missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112,879,965 (GRCm39) missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112,876,232 (GRCm39) missense probably damaging 1.00
IGL02458:Jag2 APN 12 112,879,613 (GRCm39) missense probably damaging 0.98
IGL02516:Jag2 APN 12 112,874,186 (GRCm39) missense probably damaging 1.00
IGL02574:Jag2 APN 12 112,879,131 (GRCm39) missense probably benign 0.32
IGL02629:Jag2 APN 12 112,878,134 (GRCm39) splice site probably benign
IGL02873:Jag2 APN 12 112,874,122 (GRCm39) missense probably benign 0.00
IGL03087:Jag2 APN 12 112,877,568 (GRCm39) missense possibly damaging 0.60
Jaguarundi UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R0068:Jag2 UTSW 12 112,878,813 (GRCm39) splice site probably benign
R0310:Jag2 UTSW 12 112,876,997 (GRCm39) unclassified probably benign
R0963:Jag2 UTSW 12 112,878,934 (GRCm39) missense probably damaging 1.00
R1188:Jag2 UTSW 12 112,883,741 (GRCm39) nonsense probably null
R1256:Jag2 UTSW 12 112,878,039 (GRCm39) missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112,879,939 (GRCm39) unclassified probably benign
R1317:Jag2 UTSW 12 112,878,121 (GRCm39) missense probably benign
R2345:Jag2 UTSW 12 112,872,684 (GRCm39) missense probably damaging 1.00
R4654:Jag2 UTSW 12 112,877,266 (GRCm39) missense probably benign 0.13
R4782:Jag2 UTSW 12 112,877,869 (GRCm39) missense probably benign
R4798:Jag2 UTSW 12 112,880,252 (GRCm39) missense probably benign 0.01
R5242:Jag2 UTSW 12 112,880,486 (GRCm39) missense probably damaging 0.97
R5350:Jag2 UTSW 12 112,872,542 (GRCm39) missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112,874,154 (GRCm39) missense probably damaging 1.00
R6129:Jag2 UTSW 12 112,883,969 (GRCm39) nonsense probably null
R6362:Jag2 UTSW 12 112,883,742 (GRCm39) missense probably damaging 0.97
R6376:Jag2 UTSW 12 112,872,949 (GRCm39) missense probably benign 0.00
R6819:Jag2 UTSW 12 112,874,161 (GRCm39) missense probably damaging 1.00
R6844:Jag2 UTSW 12 112,880,334 (GRCm39) missense probably damaging 1.00
R6968:Jag2 UTSW 12 112,877,878 (GRCm39) missense probably benign 0.10
R7514:Jag2 UTSW 12 112,892,672 (GRCm39) missense probably benign 0.19
R7663:Jag2 UTSW 12 112,877,286 (GRCm39) missense probably damaging 1.00
R7730:Jag2 UTSW 12 112,885,661 (GRCm39) missense probably damaging 1.00
R7754:Jag2 UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R7828:Jag2 UTSW 12 112,876,800 (GRCm39) missense probably benign 0.19
R7874:Jag2 UTSW 12 112,879,566 (GRCm39) missense probably damaging 0.99
R8075:Jag2 UTSW 12 112,878,894 (GRCm39) missense probably benign 0.05
R8845:Jag2 UTSW 12 112,883,714 (GRCm39) missense probably damaging 1.00
R8876:Jag2 UTSW 12 112,873,257 (GRCm39) missense probably benign 0.00
R9117:Jag2 UTSW 12 112,877,279 (GRCm39) nonsense probably null
R9400:Jag2 UTSW 12 112,875,608 (GRCm39) nonsense probably null
R9673:Jag2 UTSW 12 112,875,416 (GRCm39) nonsense probably null
R9688:Jag2 UTSW 12 112,872,564 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATCCTTGTTTACACACGGCTG -3'
(R):5'- GCATCCTGCTTAGAGCTTCTG -3'

Sequencing Primer
(F):5'- CTTGTTTACACACGGCTGGAACAG -3'
(R):5'- GCTTAGAGCTTCTGCCCAG -3'
Posted On 2014-09-17