Incidental Mutation 'R2079:Gm5141'
ID 229376
Institutional Source Beutler Lab
Gene Symbol Gm5141
Ensembl Gene ENSMUSG00000091183
Gene Name predicted gene 5141
Synonyms
MMRRC Submission 040084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R2079 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 62772200-62785808 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62774610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 248 (N248K)
Ref Sequence ENSEMBL: ENSMUSP00000144368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167516] [ENSMUST00000201047]
AlphaFold A0A0J9YUW3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116696
Predicted Effect probably benign
Transcript: ENSMUST00000167516
AA Change: N247K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126604
Gene: ENSMUSG00000091183
AA Change: N247K

DomainStartEndE-ValueType
KRAB 3 65 2.32e-19 SMART
ZnF_C2H2 132 154 1.51e0 SMART
ZnF_C2H2 160 182 6.52e-5 SMART
ZnF_C2H2 188 210 5.42e-2 SMART
ZnF_C2H2 216 238 1.84e-4 SMART
ZnF_C2H2 244 266 1.3e-4 SMART
ZnF_C2H2 272 294 1.22e-4 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 3.89e-3 SMART
ZnF_C2H2 384 406 4.94e-5 SMART
ZnF_C2H2 412 434 5.67e-5 SMART
ZnF_C2H2 440 462 7.49e-5 SMART
ZnF_C2H2 468 490 5.21e-4 SMART
ZnF_C2H2 496 518 4.87e-4 SMART
ZnF_C2H2 524 546 1.22e-4 SMART
ZnF_C2H2 552 574 1.18e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179519
Predicted Effect probably benign
Transcript: ENSMUST00000201047
AA Change: N248K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144368
Gene: ENSMUSG00000091183
AA Change: N248K

DomainStartEndE-ValueType
KRAB 4 66 9.8e-22 SMART
ZnF_C2H2 133 155 6.5e-3 SMART
ZnF_C2H2 161 183 2.7e-7 SMART
ZnF_C2H2 189 211 2.4e-4 SMART
ZnF_C2H2 217 239 8.1e-7 SMART
ZnF_C2H2 245 267 5.6e-7 SMART
ZnF_C2H2 273 295 5.1e-7 SMART
ZnF_C2H2 301 323 7.9e-6 SMART
ZnF_C2H2 329 351 1.2e-6 SMART
ZnF_C2H2 357 379 1.7e-5 SMART
ZnF_C2H2 385 407 2.1e-7 SMART
ZnF_C2H2 413 435 2.4e-7 SMART
ZnF_C2H2 441 463 3.2e-7 SMART
ZnF_C2H2 469 491 2.2e-6 SMART
ZnF_C2H2 497 519 2.2e-6 SMART
ZnF_C2H2 525 547 5.4e-7 SMART
ZnF_C2H2 553 575 4.9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202582
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 A T 13: 104,462,238 R862S probably benign Het
Aldoa T C 7: 126,796,904 D164G probably null Het
Ankle2 T C 5: 110,244,505 V459A probably damaging Het
Atp11a A G 8: 12,857,902 Y482C probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Cfap65 G A 1: 74,917,199 R1074C probably benign Het
Ciart G T 3: 95,879,038 H242N probably damaging Het
Cidec T A 6: 113,425,654 M220L probably benign Het
Clca1 A G 3: 145,007,773 I699T possibly damaging Het
Csf2rb2 T C 15: 78,288,007 D401G probably benign Het
Cyp2j6 C A 4: 96,531,725 L256F possibly damaging Het
Ddr2 A T 1: 170,004,776 Y148* probably null Het
Depdc5 T A 5: 32,946,674 I373N possibly damaging Het
Dpp10 A T 1: 123,432,992 M268K probably damaging Het
Fam118b C A 9: 35,223,664 V216F possibly damaging Het
Fam71b T G 11: 46,405,107 V102G probably benign Het
Fancd2 T C 6: 113,555,187 V487A probably damaging Het
Fhad1 T A 4: 141,991,202 R147* probably null Het
Flt3 A G 5: 147,355,083 S544P probably damaging Het
Frem3 C A 8: 80,615,103 Q1342K probably benign Het
Gimap4 T C 6: 48,690,947 M84T possibly damaging Het
Gm20481 T C 17: 34,970,220 K569R probably benign Het
Gm4871 A C 5: 145,029,931 D247E possibly damaging Het
Gulo A G 14: 65,990,383 Y367H probably damaging Het
Hap1 T C 11: 100,353,746 E120G probably damaging Het
Heatr3 T A 8: 88,141,776 N51K probably damaging Het
Hipk2 T C 6: 38,818,785 D183G probably damaging Het
Hnrnpll T A 17: 80,035,377 T439S probably benign Het
Hoxd3 A C 2: 74,744,266 E85D probably damaging Het
Ipo8 A T 6: 148,789,162 M694K probably damaging Het
Jag2 A G 12: 112,920,377 I194T probably damaging Het
Jrkl A T 9: 13,244,859 F266I probably damaging Het
Kcnt1 A G 2: 25,900,248 I436V possibly damaging Het
Kdm3b A T 18: 34,803,517 D284V probably damaging Het
Khdrbs2 A G 1: 32,467,874 T200A probably benign Het
Kmt2c T C 5: 25,352,280 D1143G possibly damaging Het
Kremen1 G GGGGT 11: 5,201,794 probably null Het
Lama2 A C 10: 27,369,053 I244S probably damaging Het
Lama5 G A 2: 180,225,508 P99S possibly damaging Het
Lrrc30 A T 17: 67,631,880 L235Q possibly damaging Het
Man2b2 C T 5: 36,814,372 V667M possibly damaging Het
Mmp2 T A 8: 92,850,189 N77K probably damaging Het
Myo1a A G 10: 127,720,613 E1009G probably benign Het
Ndst1 A G 18: 60,695,509 Y658H probably damaging Het
Nlrp10 A G 7: 108,925,628 L215P possibly damaging Het
Nrbp1 T C 5: 31,251,073 F526L probably benign Het
Olfr574 T A 7: 102,949,495 F333L probably benign Het
Olfr763 T C 10: 129,012,029 V248A probably damaging Het
Padi2 T C 4: 140,933,196 L329P probably damaging Het
Pcdhb20 A G 18: 37,505,171 Q250R probably benign Het
Pcdhb3 T A 18: 37,303,309 L776Q possibly damaging Het
Pik3cb A T 9: 99,060,204 M700K probably benign Het
Pla2g6 C T 15: 79,312,994 V127M probably damaging Het
Rabgef1 T C 5: 130,190,935 S80P probably damaging Het
Sema3a C T 5: 13,451,131 T47I possibly damaging Het
Sik2 C T 9: 50,907,406 probably null Het
Sin3a T C 9: 57,089,523 V112A probably benign Het
Slc26a6 G A 9: 108,859,058 A472T probably damaging Het
Syne1 A G 10: 5,361,502 V561A probably benign Het
Syt16 C T 12: 74,238,299 T422I probably damaging Het
Tlr11 A T 14: 50,360,980 H141L probably damaging Het
Tmem252 A T 19: 24,677,653 E131D probably benign Het
Trim55 T G 3: 19,644,666 L20V probably damaging Het
Uqcrfs1 A T 13: 30,541,308 V83D probably benign Het
Utf1 C T 7: 139,944,895 R309* probably null Het
Uxs1 T C 1: 43,764,973 T261A probably damaging Het
Vmn1r24 T C 6: 57,955,670 I288V probably benign Het
Vmn1r80 A T 7: 12,193,194 D77V probably damaging Het
Vmn2r74 T G 7: 85,957,175 H321P probably benign Het
Zfp638 T C 6: 83,953,389 probably null Het
Zwilch T A 9: 64,153,574 Q332L probably damaging Het
Zwilch G T 9: 64,153,575 Q332K probably damaging Het
Other mutations in Gm5141
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0220:Gm5141 UTSW 13 62774457 missense probably damaging 1.00
R0427:Gm5141 UTSW 13 62774711 missense probably damaging 1.00
R0534:Gm5141 UTSW 13 62774594 missense probably damaging 1.00
R0652:Gm5141 UTSW 13 62774132 missense probably damaging 1.00
R1495:Gm5141 UTSW 13 62774270 missense probably damaging 1.00
R4780:Gm5141 UTSW 13 62774950 missense unknown
R5588:Gm5141 UTSW 13 62773770 missense probably benign 0.06
R6292:Gm5141 UTSW 13 62774438 missense probably damaging 1.00
R6455:Gm5141 UTSW 13 62774783 missense probably damaging 1.00
R6605:Gm5141 UTSW 13 62774387 missense probably damaging 1.00
R7091:Gm5141 UTSW 13 62773964 missense possibly damaging 0.80
R7199:Gm5141 UTSW 13 62777063 missense possibly damaging 0.92
R8933:Gm5141 UTSW 13 62777040 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTGTCGTGAAAAGACTTTATCACAA -3'
(R):5'- TGCATGTCCCAGTCTTCTTAAA -3'

Sequencing Primer
(F):5'- TGGGAAAAAGCTTTATCACACTG -3'
(R):5'- GTCCCAGTCTTCTTAAAAGGCATG -3'
Posted On 2014-09-17