Mutagenetix > Incidental Mutation

Incidental Mutation 'R2079:Ndst1'

229391

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

040084-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2079 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60695509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 658 (Y658H)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably damaging
Transcript: ENSMUST00000169273
AA Change: Y658H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: Y658H

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	A	T	13: 104,462,238	R862S	probably benign	Het
Aldoa	T	C	7: 126,796,904	D164G	probably null	Het
Ankle2	T	C	5: 110,244,505	V459A	probably damaging	Het
Atp11a	A	G	8: 12,857,902	Y482C	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Cfap65	G	A	1: 74,917,199	R1074C	probably benign	Het
Ciart	G	T	3: 95,879,038	H242N	probably damaging	Het
Cidec	T	A	6: 113,425,654	M220L	probably benign	Het
Clca1	A	G	3: 145,007,773	I699T	possibly damaging	Het
Csf2rb2	T	C	15: 78,288,007	D401G	probably benign	Het
Cyp2j6	C	A	4: 96,531,725	L256F	possibly damaging	Het
Ddr2	A	T	1: 170,004,776	Y148*	probably null	Het
Depdc5	T	A	5: 32,946,674	I373N	possibly damaging	Het
Dpp10	A	T	1: 123,432,992	M268K	probably damaging	Het
Fam118b	C	A	9: 35,223,664	V216F	possibly damaging	Het
Fam71b	T	G	11: 46,405,107	V102G	probably benign	Het
Fancd2	T	C	6: 113,555,187	V487A	probably damaging	Het
Fhad1	T	A	4: 141,991,202	R147*	probably null	Het
Flt3	A	G	5: 147,355,083	S544P	probably damaging	Het
Frem3	C	A	8: 80,615,103	Q1342K	probably benign	Het
Gimap4	T	C	6: 48,690,947	M84T	possibly damaging	Het
Gm20481	T	C	17: 34,970,220	K569R	probably benign	Het
Gm4871	A	C	5: 145,029,931	D247E	possibly damaging	Het
Gm5141	A	T	13: 62,774,610	N248K	probably benign	Het
Gulo	A	G	14: 65,990,383	Y367H	probably damaging	Het
Hap1	T	C	11: 100,353,746	E120G	probably damaging	Het
Heatr3	T	A	8: 88,141,776	N51K	probably damaging	Het
Hipk2	T	C	6: 38,818,785	D183G	probably damaging	Het
Hnrnpll	T	A	17: 80,035,377	T439S	probably benign	Het
Hoxd3	A	C	2: 74,744,266	E85D	probably damaging	Het
Ipo8	A	T	6: 148,789,162	M694K	probably damaging	Het
Jag2	A	G	12: 112,920,377	I194T	probably damaging	Het
Jrkl	A	T	9: 13,244,859	F266I	probably damaging	Het
Kcnt1	A	G	2: 25,900,248	I436V	possibly damaging	Het
Kdm3b	A	T	18: 34,803,517	D284V	probably damaging	Het
Khdrbs2	A	G	1: 32,467,874	T200A	probably benign	Het
Kmt2c	T	C	5: 25,352,280	D1143G	possibly damaging	Het
Kremen1	G	GGGGT	11: 5,201,794		probably null	Het
Lama2	A	C	10: 27,369,053	I244S	probably damaging	Het
Lama5	G	A	2: 180,225,508	P99S	possibly damaging	Het
Lrrc30	A	T	17: 67,631,880	L235Q	possibly damaging	Het
Man2b2	C	T	5: 36,814,372	V667M	possibly damaging	Het
Mmp2	T	A	8: 92,850,189	N77K	probably damaging	Het
Myo1a	A	G	10: 127,720,613	E1009G	probably benign	Het
Nlrp10	A	G	7: 108,925,628	L215P	possibly damaging	Het
Nrbp1	T	C	5: 31,251,073	F526L	probably benign	Het
Olfr574	T	A	7: 102,949,495	F333L	probably benign	Het
Olfr763	T	C	10: 129,012,029	V248A	probably damaging	Het
Padi2	T	C	4: 140,933,196	L329P	probably damaging	Het
Pcdhb20	A	G	18: 37,505,171	Q250R	probably benign	Het
Pcdhb3	T	A	18: 37,303,309	L776Q	possibly damaging	Het
Pik3cb	A	T	9: 99,060,204	M700K	probably benign	Het
Pla2g6	C	T	15: 79,312,994	V127M	probably damaging	Het
Rabgef1	T	C	5: 130,190,935	S80P	probably damaging	Het
Sema3a	C	T	5: 13,451,131	T47I	possibly damaging	Het
Sik2	C	T	9: 50,907,406		probably null	Het
Sin3a	T	C	9: 57,089,523	V112A	probably benign	Het
Slc26a6	G	A	9: 108,859,058	A472T	probably damaging	Het
Syne1	A	G	10: 5,361,502	V561A	probably benign	Het
Syt16	C	T	12: 74,238,299	T422I	probably damaging	Het
Tlr11	A	T	14: 50,360,980	H141L	probably damaging	Het
Tmem252	A	T	19: 24,677,653	E131D	probably benign	Het
Trim55	T	G	3: 19,644,666	L20V	probably damaging	Het
Uqcrfs1	A	T	13: 30,541,308	V83D	probably benign	Het
Utf1	C	T	7: 139,944,895	R309*	probably null	Het
Uxs1	T	C	1: 43,764,973	T261A	probably damaging	Het
Vmn1r24	T	C	6: 57,955,670	I288V	probably benign	Het
Vmn1r80	A	T	7: 12,193,194	D77V	probably damaging	Het
Vmn2r74	T	G	7: 85,957,175	H321P	probably benign	Het
Zfp638	T	C	6: 83,953,389		probably null	Het
Zwilch	T	A	9: 64,153,574	Q332L	probably damaging	Het
Zwilch	G	T	9: 64,153,575	Q332K	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTACCAGGAATAAGCCCG -3'
(R):5'- TGACTCCATGACACCCACTGAG -3'

Sequencing Primer
(F):5'- CAGGAATAAGCCCGGTCGG -3'
(R):5'- AAGTGGCAGCTCTTCCCAG -3'

Posted On

2014-09-17