Mutagenetix > Incidental Mutation

Incidental Mutation 'R2080:Dsel'

229396

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

040085-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.126) question?

Stock #

R2080 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111859962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 948 (T948A)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably benign
Transcript: ENSMUST00000035462
AA Change: T948A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: T948A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189731

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,971,933	D183V	probably damaging	Het
Ambra1	T	A	2: 91,885,719	D858E	probably damaging	Het
Amdhd2	T	C	17: 24,156,604	T370A	probably benign	Het
Amy1	A	G	3: 113,558,094	W449R	probably benign	Het
Aox3	A	T	1: 58,186,280	I1179F	probably benign	Het
Atp10a	C	A	7: 58,824,327	Q1121K	probably damaging	Het
Btaf1	C	T	19: 36,951,148	A123V	probably benign	Het
Car6	T	C	4: 150,198,141	K16E	probably benign	Het
Cgnl1	C	T	9: 71,656,096	D779N	probably benign	Het
Cyp2a4	G	A	7: 26,308,537	R123Q	possibly damaging	Het
D430041D05Rik	C	T	2: 104,156,816	R1895Q	probably damaging	Het
D5Ertd579e	T	A	5: 36,616,206	T282S	probably benign	Het
Ednrb	A	T	14: 103,843,100	I126N	probably damaging	Het
Egln1	A	G	8: 124,948,306	M250T	probably benign	Het
Epb41l3	A	T	17: 69,253,468	I337L	possibly damaging	Het
Epg5	T	C	18: 77,948,745	I219T	probably benign	Het
Gm13030	T	C	4: 138,873,419		probably benign	Het
Gm1527	T	A	3: 28,926,661	C637S	probably benign	Het
Hist1h1a	A	G	13: 23,763,949	N78S	possibly damaging	Het
Insrr	T	C	3: 87,814,291	I1168T	possibly damaging	Het
Ireb2	T	C	9: 54,896,552	V509A	possibly damaging	Het
Kmt2c	T	C	5: 25,354,717	D981G	probably damaging	Het
Ktn1	A	G	14: 47,725,960	E1164G	probably damaging	Het
L3hypdh	A	T	12: 72,079,527	V213E	probably damaging	Het
Masp1	T	G	16: 23,491,959	D241A	probably damaging	Het
Mfsd13b	A	G	7: 120,991,824	I1V	probably null	Het
Muc5b	T	C	7: 141,869,754	V4531A	probably benign	Het
Myh2	A	T	11: 67,174,941		probably null	Het
Naip5	A	G	13: 100,221,533	L1065P	probably damaging	Het
Necab1	T	C	4: 15,140,219		probably benign	Het
Nemf	A	G	12: 69,353,786		probably benign	Het
Nfil3	A	T	13: 52,968,033	D278E	possibly damaging	Het
Nup98	T	C	7: 102,180,424	N393S	probably damaging	Het
Ogdh	T	A	11: 6,349,393	M753K	probably benign	Het
Olfr11	A	T	13: 21,639,436	V29E	probably damaging	Het
Olfr1297	C	T	2: 111,621,739	V112M	probably benign	Het
Olfr273	T	C	4: 52,855,568	Y315C	probably benign	Het
Olfr561	T	C	7: 102,775,243	F240L	probably benign	Het
Olfr901	T	A	9: 38,431,082	S267T	probably benign	Het
Pkd2	A	G	5: 104,477,123	K262E	probably benign	Het
Plce1	C	T	19: 38,727,013		probably benign	Het
Ppm1f	T	A	16: 16,923,880	M406K	possibly damaging	Het
Ptgs1	C	T	2: 36,242,847	Q286*	probably null	Het
Scube2	T	C	7: 109,808,505	T743A	possibly damaging	Het
Tipin	T	A	9: 64,290,376	L69*	probably null	Het
Tlk1	T	A	2: 70,738,445	K404N	probably damaging	Het
Tmem59	C	A	4: 107,178,774	L16I	probably damaging	Het
Utrn	T	C	10: 12,737,082	E426G	probably benign	Het
Xdh	A	T	17: 73,909,325	S709T	probably damaging	Het
Yjefn3	T	C	8: 69,889,487	N28D	probably damaging	Het
Zfp598	A	C	17: 24,679,667	D480A	probably damaging	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8820:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAAGCTTCAATGTCCAGCTACC -3'
(R):5'- CAGAATTCCTACAGCCTACATGG -3'

Sequencing Primer
(F):5'- ATGTCCAGCTACCACTACTTAAGCTG -3'
(R):5'- GCCTACATGGATATCCCTGAAACTG -3'

Posted On

2014-09-17