Incidental Mutation 'R2080:Ptgs1'
ID 229397
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Name prostaglandin-endoperoxide synthase 1
Synonyms Pghs1, Cox-1, COX1, cyclooxygenase 1, Cox-3
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36120438-36142284 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 36132859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 286 (Q286*)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
AlphaFold P22437
Predicted Effect probably null
Transcript: ENSMUST00000062069
AA Change: Q286*
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: Q286*

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151351
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36,127,231 (GRCm39) missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36,132,983 (GRCm39) missense probably null 0.93
IGL02952:Ptgs1 APN 2 36,141,253 (GRCm39) missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36,127,717 (GRCm39) missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36,130,692 (GRCm39) missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36,139,205 (GRCm39) missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36,130,868 (GRCm39) splice site probably benign
R1563:Ptgs1 UTSW 2 36,135,214 (GRCm39) missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36,132,782 (GRCm39) missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36,127,668 (GRCm39) missense probably benign
R2116:Ptgs1 UTSW 2 36,127,708 (GRCm39) nonsense probably null
R4073:Ptgs1 UTSW 2 36,127,788 (GRCm39) missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36,141,346 (GRCm39) missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36,127,267 (GRCm39) missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36,127,294 (GRCm39) missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36,141,272 (GRCm39) missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36,141,198 (GRCm39) missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36,141,198 (GRCm39) missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36,127,234 (GRCm39) missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36,135,280 (GRCm39) missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36,141,089 (GRCm39) missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36,141,190 (GRCm39) missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36,141,131 (GRCm39) missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36,127,297 (GRCm39) missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36,141,311 (GRCm39) missense probably benign
R7020:Ptgs1 UTSW 2 36,141,041 (GRCm39) missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36,135,222 (GRCm39) missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36,135,223 (GRCm39) missense possibly damaging 0.92
R7873:Ptgs1 UTSW 2 36,141,292 (GRCm39) missense probably damaging 1.00
R8215:Ptgs1 UTSW 2 36,141,179 (GRCm39) missense probably damaging 1.00
R9244:Ptgs1 UTSW 2 36,130,724 (GRCm39) missense probably damaging 0.96
R9537:Ptgs1 UTSW 2 36,120,739 (GRCm39) missense unknown
R9709:Ptgs1 UTSW 2 36,141,204 (GRCm39) missense probably damaging 1.00
Z1176:Ptgs1 UTSW 2 36,130,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGCTGAGGTAGTAAAGTC -3'
(R):5'- GTTCAGTAACACCAGGGTCC -3'

Sequencing Primer
(F):5'- TCGGAACACAGGAGCCG -3'
(R):5'- GTTCAGTAACACCAGGGTCCTAACC -3'
Posted On 2014-09-17