Mutagenetix > Incidental Mutation

Incidental Mutation 'R2080:Ptgs1'

229397

Institutional Source

Beutler Lab

Gene Symbol

Ptgs1

Ensembl Gene

ENSMUSG00000047250

Gene Name

prostaglandin-endoperoxide synthase 1

Synonyms

Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1

MMRRC Submission

040085-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.390) question?

Stock #

R2080 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36230426-36252272 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 36242847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 286 (Q286*)

Ref Sequence

ENSEMBL: ENSMUSP00000059977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062069]

AlphaFold

P22437

Predicted Effect

probably null
Transcript: ENSMUST00000062069
AA Change: Q286*

SMART Domains

Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: Q286*

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
EGF	37	72	2.48e1	SMART
low complexity region	172	185	N/A	INTRINSIC
low complexity region	200	214	N/A	INTRINSIC
Pfam:An_peroxidase	221	528	1.5e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144319

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149930

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151351

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,971,933	D183V	probably damaging	Het
Ambra1	T	A	2: 91,885,719	D858E	probably damaging	Het
Amdhd2	T	C	17: 24,156,604	T370A	probably benign	Het
Amy1	A	G	3: 113,558,094	W449R	probably benign	Het
Aox3	A	T	1: 58,186,280	I1179F	probably benign	Het
Atp10a	C	A	7: 58,824,327	Q1121K	probably damaging	Het
Btaf1	C	T	19: 36,951,148	A123V	probably benign	Het
Car6	T	C	4: 150,198,141	K16E	probably benign	Het
Cgnl1	C	T	9: 71,656,096	D779N	probably benign	Het
Cyp2a4	G	A	7: 26,308,537	R123Q	possibly damaging	Het
D430041D05Rik	C	T	2: 104,156,816	R1895Q	probably damaging	Het
D5Ertd579e	T	A	5: 36,616,206	T282S	probably benign	Het
Dsel	T	C	1: 111,859,962	T948A	probably benign	Het
Ednrb	A	T	14: 103,843,100	I126N	probably damaging	Het
Egln1	A	G	8: 124,948,306	M250T	probably benign	Het
Epb41l3	A	T	17: 69,253,468	I337L	possibly damaging	Het
Epg5	T	C	18: 77,948,745	I219T	probably benign	Het
Gm13030	T	C	4: 138,873,419		probably benign	Het
Gm1527	T	A	3: 28,926,661	C637S	probably benign	Het
Hist1h1a	A	G	13: 23,763,949	N78S	possibly damaging	Het
Insrr	T	C	3: 87,814,291	I1168T	possibly damaging	Het
Ireb2	T	C	9: 54,896,552	V509A	possibly damaging	Het
Kmt2c	T	C	5: 25,354,717	D981G	probably damaging	Het
Ktn1	A	G	14: 47,725,960	E1164G	probably damaging	Het
L3hypdh	A	T	12: 72,079,527	V213E	probably damaging	Het
Masp1	T	G	16: 23,491,959	D241A	probably damaging	Het
Mfsd13b	A	G	7: 120,991,824	I1V	probably null	Het
Muc5b	T	C	7: 141,869,754	V4531A	probably benign	Het
Myh2	A	T	11: 67,174,941		probably null	Het
Naip5	A	G	13: 100,221,533	L1065P	probably damaging	Het
Necab1	T	C	4: 15,140,219		probably benign	Het
Nemf	A	G	12: 69,353,786		probably benign	Het
Nfil3	A	T	13: 52,968,033	D278E	possibly damaging	Het
Nup98	T	C	7: 102,180,424	N393S	probably damaging	Het
Ogdh	T	A	11: 6,349,393	M753K	probably benign	Het
Olfr11	A	T	13: 21,639,436	V29E	probably damaging	Het
Olfr1297	C	T	2: 111,621,739	V112M	probably benign	Het
Olfr273	T	C	4: 52,855,568	Y315C	probably benign	Het
Olfr561	T	C	7: 102,775,243	F240L	probably benign	Het
Olfr901	T	A	9: 38,431,082	S267T	probably benign	Het
Pkd2	A	G	5: 104,477,123	K262E	probably benign	Het
Plce1	C	T	19: 38,727,013		probably benign	Het
Ppm1f	T	A	16: 16,923,880	M406K	possibly damaging	Het
Scube2	T	C	7: 109,808,505	T743A	possibly damaging	Het
Tipin	T	A	9: 64,290,376	L69*	probably null	Het
Tlk1	T	A	2: 70,738,445	K404N	probably damaging	Het
Tmem59	C	A	4: 107,178,774	L16I	probably damaging	Het
Utrn	T	C	10: 12,737,082	E426G	probably benign	Het
Xdh	A	T	17: 73,909,325	S709T	probably damaging	Het
Yjefn3	T	C	8: 69,889,487	N28D	probably damaging	Het
Zfp598	A	C	17: 24,679,667	D480A	probably damaging	Het

Other mutations in Ptgs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Ptgs1	APN	2	36237219	missense	probably damaging	1.00
IGL02345:Ptgs1	APN	2	36242971	missense	probably null	0.93
IGL02952:Ptgs1	APN	2	36251241	missense	probably benign	0.00
IGL03306:Ptgs1	APN	2	36237705	missense	probably damaging	1.00
PIT4431001:Ptgs1	UTSW	2	36240680	missense	probably damaging	1.00
R0468:Ptgs1	UTSW	2	36249193	missense	probably damaging	1.00
R0638:Ptgs1	UTSW	2	36240856	splice site	probably benign
R1563:Ptgs1	UTSW	2	36245202	missense	possibly damaging	0.53
R1858:Ptgs1	UTSW	2	36242770	missense	probably benign	0.19
R2012:Ptgs1	UTSW	2	36237656	missense	probably benign
R2116:Ptgs1	UTSW	2	36237696	nonsense	probably null
R4073:Ptgs1	UTSW	2	36237776	missense	probably damaging	1.00
R4163:Ptgs1	UTSW	2	36251334	missense	possibly damaging	0.87
R4862:Ptgs1	UTSW	2	36237255	missense	probably damaging	1.00
R5062:Ptgs1	UTSW	2	36237282	missense	probably damaging	1.00
R5071:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5072:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5073:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5074:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5373:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5374:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5419:Ptgs1	UTSW	2	36237222	missense	probably damaging	1.00
R5428:Ptgs1	UTSW	2	36245268	missense	probably benign	0.00
R5918:Ptgs1	UTSW	2	36251077	missense	probably damaging	1.00
R6134:Ptgs1	UTSW	2	36251178	missense	probably damaging	1.00
R6181:Ptgs1	UTSW	2	36251119	missense	probably damaging	1.00
R6240:Ptgs1	UTSW	2	36237285	missense	probably damaging	1.00
R6979:Ptgs1	UTSW	2	36251299	missense	probably benign
R7020:Ptgs1	UTSW	2	36251029	missense	probably damaging	1.00
R7445:Ptgs1	UTSW	2	36245210	missense	probably benign	0.06
R7557:Ptgs1	UTSW	2	36245211	missense	possibly damaging	0.92
R7873:Ptgs1	UTSW	2	36251280	missense	probably damaging	1.00
R8215:Ptgs1	UTSW	2	36251167	missense	probably damaging	1.00
R9244:Ptgs1	UTSW	2	36240712	missense	probably damaging	0.96
R9537:Ptgs1	UTSW	2	36230727	missense	unknown
R9709:Ptgs1	UTSW	2	36251192	missense	probably damaging	1.00
Z1176:Ptgs1	UTSW	2	36240776	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGGCTGAGGTAGTAAAGTC -3'
(R):5'- GTTCAGTAACACCAGGGTCC -3'

Sequencing Primer
(F):5'- TCGGAACACAGGAGCCG -3'
(R):5'- GTTCAGTAACACCAGGGTCCTAACC -3'

Posted On

2014-09-17