Incidental Mutation 'R2080:Tlk1'
ID229398
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70738445 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 404 (K404N)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584]
Predicted Effect probably damaging
Transcript: ENSMUST00000038584
AA Change: K404N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: K404N

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135128
Meta Mutation Damage Score 0.1828 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
Aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 synonymous probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R3970:Tlk1 UTSW 2 70716652 missense probably damaging 1.00
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6592:Tlk1 UTSW 2 70714153 missense probably damaging 1.00
R6797:Tlk1 UTSW 2 70738426 nonsense probably null
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
R7705:Tlk1 UTSW 2 70786672 intron probably null
R7970:Tlk1 UTSW 2 70752300 missense possibly damaging 0.64
R8284:Tlk1 UTSW 2 70714021 missense probably benign
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGCATCACATCCAACTGG -3'
(R):5'- CCAAGCAGAAATGGTAAAATTGTGC -3'

Sequencing Primer
(F):5'- TCCAACTGGACCAACTATCTAGAG -3'
(R):5'- AGGATCATAAAGGGGTTTTTCGACC -3'
Posted On2014-09-17