Incidental Mutation 'R0157:Prpf4b'
ID 22940
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Name pre-mRNA processing factor 4B
Synonyms Prp4, Prp4k, Prpk
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0157 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 34875302-34906064 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 34884031 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
AlphaFold Q61136
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: V281A
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: V281A

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221639
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: V281A
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
R7966:Prpf4b UTSW 13 34901445 missense probably damaging 0.96
R8241:Prpf4b UTSW 13 34895991 missense probably damaging 1.00
R8298:Prpf4b UTSW 13 34888183 missense unknown
RF002:Prpf4b UTSW 13 34884236 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTCTTCCAGTACTCGGGGAAAAC -3'
(R):5'- CGAGAAGGCGATTTGCTCTGCTTAG -3'

Sequencing Primer
(F):5'- TACTCGGGGAAAACTTGAAATTACG -3'
(R):5'- CTTTTAGGACTACGGCCAGG -3'
Posted On 2013-04-16