Incidental Mutation 'R2080:D430041D05Rik'
ID 229400
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene Name RIKEN cDNA D430041D05 gene
Synonyms G2
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103973418-104241358 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103987161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1895 (R1895Q)
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
AlphaFold A0A2R8VKG2
Predicted Effect probably damaging
Transcript: ENSMUST00000089726
AA Change: R1210Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: R1210Q

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136156
AA Change: R1211Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000141159
AA Change: R1096Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: R1096Q

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155458
Predicted Effect probably damaging
Transcript: ENSMUST00000230671
AA Change: R1895Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104,031,648 (GRCm39) missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104,088,511 (GRCm39) nonsense probably null
IGL01669:D430041D05Rik APN 2 104,085,306 (GRCm39) missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104,060,749 (GRCm39) missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104,038,559 (GRCm39) splice site probably benign
IGL02268:D430041D05Rik APN 2 104,071,500 (GRCm39) missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104,085,351 (GRCm39) missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104,079,690 (GRCm39) missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104,060,631 (GRCm39) missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104,078,611 (GRCm39) missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104,060,650 (GRCm39) missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104,044,604 (GRCm39) missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104,071,508 (GRCm39) missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104,051,556 (GRCm39) missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104,078,719 (GRCm39) missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104,085,389 (GRCm39) missense probably benign
R0064:D430041D05Rik UTSW 2 104,079,502 (GRCm39) missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104,085,379 (GRCm39) missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104,035,545 (GRCm39) missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104,031,589 (GRCm39) missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104,085,685 (GRCm39) missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 103,998,509 (GRCm39) missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 103,998,292 (GRCm39) missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104,063,790 (GRCm39) missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104,063,790 (GRCm39) missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 103,998,295 (GRCm39) missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104,060,651 (GRCm39) missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104,060,773 (GRCm39) missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104,079,690 (GRCm39) missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104,088,674 (GRCm39) missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104,031,648 (GRCm39) missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 103,985,363 (GRCm39) missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104,038,428 (GRCm39) missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104,051,553 (GRCm39) small deletion probably benign
R1604:D430041D05Rik UTSW 2 104,035,487 (GRCm39) missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104,085,915 (GRCm39) missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 103,983,308 (GRCm39) missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104,051,556 (GRCm39) missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 103,998,446 (GRCm39) missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104,060,800 (GRCm39) missense probably benign 0.39
R2101:D430041D05Rik UTSW 2 103,979,175 (GRCm39) missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 103,987,161 (GRCm39) missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104,085,660 (GRCm39) missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104,085,403 (GRCm39) missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104,044,522 (GRCm39) missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104,087,713 (GRCm39) missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104,086,684 (GRCm39) missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104,022,778 (GRCm39) critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104,063,824 (GRCm39) missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104,038,528 (GRCm39) missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104,038,528 (GRCm39) missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104,088,788 (GRCm39) missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104,044,441 (GRCm39) missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104,031,455 (GRCm39) critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104,085,754 (GRCm39) missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104,085,732 (GRCm39) missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104,088,847 (GRCm39) missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104,086,945 (GRCm39) missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104,085,754 (GRCm39) missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104,078,629 (GRCm39) missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104,078,630 (GRCm39) missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 103,998,412 (GRCm39) missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104,086,637 (GRCm39) missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 103,998,548 (GRCm39) splice site probably null
R6804:D430041D05Rik UTSW 2 103,979,371 (GRCm39) missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104,031,604 (GRCm39) missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104,071,500 (GRCm39) missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104,022,883 (GRCm39) missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104,088,698 (GRCm39) missense probably benign 0.06
R7250:D430041D05Rik UTSW 2 104,086,961 (GRCm39) missense possibly damaging 0.92
R7251:D430041D05Rik UTSW 2 104,051,511 (GRCm39) missense probably damaging 1.00
R7313:D430041D05Rik UTSW 2 104,085,910 (GRCm39) missense probably benign
R7359:D430041D05Rik UTSW 2 104,044,482 (GRCm39) missense probably damaging 1.00
R7361:D430041D05Rik UTSW 2 104,085,363 (GRCm39) missense possibly damaging 0.46
R7436:D430041D05Rik UTSW 2 104,087,447 (GRCm39) missense probably benign 0.02
R7472:D430041D05Rik UTSW 2 104,240,484 (GRCm39) missense unknown
R7492:D430041D05Rik UTSW 2 104,031,650 (GRCm39) missense probably damaging 1.00
R7631:D430041D05Rik UTSW 2 103,979,363 (GRCm39) nonsense probably null
R7672:D430041D05Rik UTSW 2 104,071,581 (GRCm39) missense probably benign 0.01
R7721:D430041D05Rik UTSW 2 104,088,874 (GRCm39) missense probably benign 0.00
R7754:D430041D05Rik UTSW 2 104,087,504 (GRCm39) missense probably benign 0.01
R7882:D430041D05Rik UTSW 2 104,087,974 (GRCm39) nonsense probably null
R7896:D430041D05Rik UTSW 2 104,088,385 (GRCm39) missense probably benign 0.05
R7986:D430041D05Rik UTSW 2 104,087,096 (GRCm39) missense probably damaging 1.00
R8005:D430041D05Rik UTSW 2 104,088,599 (GRCm39) missense possibly damaging 0.72
R8016:D430041D05Rik UTSW 2 104,022,864 (GRCm39) missense probably damaging 1.00
R8054:D430041D05Rik UTSW 2 103,985,390 (GRCm39) missense possibly damaging 0.93
R8058:D430041D05Rik UTSW 2 103,979,128 (GRCm39) makesense probably null
R8100:D430041D05Rik UTSW 2 104,087,287 (GRCm39) missense probably benign 0.00
R8461:D430041D05Rik UTSW 2 103,998,280 (GRCm39) missense possibly damaging 0.46
R8695:D430041D05Rik UTSW 2 104,085,299 (GRCm39) critical splice donor site probably null
R8885:D430041D05Rik UTSW 2 104,071,538 (GRCm39) missense probably damaging 1.00
R9007:D430041D05Rik UTSW 2 104,087,930 (GRCm39) missense probably benign 0.08
R9009:D430041D05Rik UTSW 2 104,240,521 (GRCm39) start gained probably benign
R9335:D430041D05Rik UTSW 2 104,078,674 (GRCm39) missense probably damaging 1.00
R9348:D430041D05Rik UTSW 2 104,088,337 (GRCm39) missense probably benign 0.05
R9384:D430041D05Rik UTSW 2 104,087,920 (GRCm39) missense probably benign
R9483:D430041D05Rik UTSW 2 104,087,563 (GRCm39) missense probably benign 0.44
R9489:D430041D05Rik UTSW 2 104,087,189 (GRCm39) missense probably benign 0.20
R9605:D430041D05Rik UTSW 2 104,087,189 (GRCm39) missense probably benign 0.20
R9613:D430041D05Rik UTSW 2 104,060,737 (GRCm39) missense probably benign 0.09
R9698:D430041D05Rik UTSW 2 103,985,396 (GRCm39) missense probably damaging 1.00
X0024:D430041D05Rik UTSW 2 104,022,911 (GRCm39) critical splice acceptor site probably null
Z1176:D430041D05Rik UTSW 2 104,087,201 (GRCm39) missense probably benign 0.00
Z1176:D430041D05Rik UTSW 2 103,985,280 (GRCm39) missense probably damaging 1.00
Z1177:D430041D05Rik UTSW 2 104,071,536 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CACGGAACCACCTTGAAGAG -3'
(R):5'- ATAAGACCGGGGATTGCCTG -3'

Sequencing Primer
(F):5'- GGGGCAGGGACCAATAAACTC -3'
(R):5'- CCTGAAGGAAGATCTAGGGAACTCC -3'
Posted On 2014-09-17