Incidental Mutation 'R2080:2310003L06Rik'
ID 229412
Institutional Source Beutler Lab
Gene Symbol 2310003L06Rik
Ensembl Gene ENSMUSG00000007457
Gene Name RIKEN cDNA 2310003L06 gene
Synonyms
MMRRC Submission 040085-MU
Accession Numbers

Genbank: AK009122; MGI: 1921498

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 87969459-87972870 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87971933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 183 (D183V)
Ref Sequence ENSEMBL: ENSMUSP00000007601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007601] [ENSMUST00000187738]
AlphaFold Q9CV82
Predicted Effect probably damaging
Transcript: ENSMUST00000007601
AA Change: D183V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007601
Gene: ENSMUSG00000007457
AA Change: D183V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in 2310003L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:2310003L06Rik APN 5 87972790 missense probably benign 0.37
IGL01938:2310003L06Rik APN 5 87971708 missense probably damaging 0.99
IGL03032:2310003L06Rik APN 5 87971915 missense possibly damaging 0.94
D3080:2310003L06Rik UTSW 5 87971987 missense possibly damaging 0.53
G1Funyon:2310003L06Rik UTSW 5 87972505 missense probably benign 0.01
IGL02984:2310003L06Rik UTSW 5 87972803 missense probably damaging 0.97
PIT4243001:2310003L06Rik UTSW 5 87972140 missense possibly damaging 0.95
R0359:2310003L06Rik UTSW 5 87964596 unclassified probably benign
R0676:2310003L06Rik UTSW 5 87964657 unclassified probably benign
R1524:2310003L06Rik UTSW 5 87971689 missense probably benign 0.37
R1536:2310003L06Rik UTSW 5 87970665 missense probably benign
R1998:2310003L06Rik UTSW 5 87970694 missense probably damaging 0.98
R2132:2310003L06Rik UTSW 5 87964476 unclassified probably benign
R2177:2310003L06Rik UTSW 5 87972453 missense probably damaging 0.98
R2399:2310003L06Rik UTSW 5 87972479 missense probably damaging 0.98
R3748:2310003L06Rik UTSW 5 87964563 unclassified probably benign
R4010:2310003L06Rik UTSW 5 87972277 missense probably damaging 0.96
R4096:2310003L06Rik UTSW 5 87972149 missense possibly damaging 0.57
R4656:2310003L06Rik UTSW 5 87964675 unclassified probably benign
R4823:2310003L06Rik UTSW 5 87972598 missense probably benign 0.00
R5753:2310003L06Rik UTSW 5 87972515 missense probably damaging 0.99
R6087:2310003L06Rik UTSW 5 87971762 missense possibly damaging 0.94
R6931:2310003L06Rik UTSW 5 87970702 missense probably damaging 0.97
R7032:2310003L06Rik UTSW 5 87972579 missense possibly damaging 0.79
R7703:2310003L06Rik UTSW 5 87972812 missense possibly damaging 0.90
R7912:2310003L06Rik UTSW 5 87972592 missense probably benign 0.35
R8185:2310003L06Rik UTSW 5 87972152 missense possibly damaging 0.73
R8301:2310003L06Rik UTSW 5 87972505 missense probably benign 0.01
R9010:2310003L06Rik UTSW 5 87971645 missense possibly damaging 0.68
R9179:2310003L06Rik UTSW 5 87972031 missense probably benign 0.00
R9225:2310003L06Rik UTSW 5 87972574 missense probably benign
R9226:2310003L06Rik UTSW 5 87970659 start codon destroyed probably benign 0.14
R9309:2310003L06Rik UTSW 5 87972473 missense probably damaging 0.99
R9373:2310003L06Rik UTSW 5 87972809 missense probably benign 0.37
R9431:2310003L06Rik UTSW 5 87972466 missense possibly damaging 0.78
Z1088:2310003L06Rik UTSW 5 87972306 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCTTTGCTTATGCCAAAGG -3'
(R):5'- AGTAGTGGTACCAGTTCCAAGAAAAC -3'

Sequencing Primer
(F):5'- CTTTGCTTATGCCAAAGGGACAG -3'
(R):5'- GTACCAGTTCCAAGAAAACTCTGTTC -3'
Posted On 2014-09-17