Incidental Mutation 'R2080:Atp10a'
ID 229415
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene Name ATPase, class V, type 10A
Synonyms Atp10c, pfatp
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 58656166-58829420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 58824327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1121 (Q1121K)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
AlphaFold O54827
Predicted Effect probably damaging
Transcript: ENSMUST00000168747
AA Change: Q1121K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: Q1121K

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Meta Mutation Damage Score 0.9092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
R8166:Atp10a UTSW 7 58807522 missense possibly damaging 0.46
R8201:Atp10a UTSW 7 58819676 nonsense probably null
R8465:Atp10a UTSW 7 58828310 missense probably benign 0.32
R8858:Atp10a UTSW 7 58816223 missense probably damaging 1.00
R8985:Atp10a UTSW 7 58788344 missense probably benign 0.03
R9003:Atp10a UTSW 7 58807455 missense probably damaging 1.00
R9274:Atp10a UTSW 7 58828621 missense probably benign 0.22
R9385:Atp10a UTSW 7 58828139 missense probably benign 0.00
R9432:Atp10a UTSW 7 58819670 missense possibly damaging 0.95
R9454:Atp10a UTSW 7 58658591 missense probably benign
R9596:Atp10a UTSW 7 58827805 missense probably damaging 1.00
R9736:Atp10a UTSW 7 58824330 missense probably damaging 1.00
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGCTGGAATTTAGGGCTG -3'
(R):5'- AGACACAGGGAGCTTACCTC -3'

Sequencing Primer
(F):5'- GCCTTTTGGGAAGAAATCACTGCC -3'
(R):5'- CCATGTTTTGGCCACTCTTGTAAAG -3'
Posted On 2014-09-17