Mutagenetix > Incidental Mutation

Incidental Mutation 'R2080:Nup98'

229416

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

040085-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2080 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102119398-102210176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102180424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 393 (N393S)

Ref Sequence

ENSEMBL: ENSMUSP00000148115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070165
AA Change: N393S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: N393S

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209242

Predicted Effect

probably damaging
Transcript: ENSMUST00000210682
AA Change: N393S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211005
AA Change: N393S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000211022

Predicted Effect

probably benign
Transcript: ENSMUST00000211235

Predicted Effect

unknown
Transcript: ENSMUST00000211764
AA Change: N65S

Meta Mutation Damage Score

0.0634

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,971,933	D183V	probably damaging	Het
Ambra1	T	A	2: 91,885,719	D858E	probably damaging	Het
Amdhd2	T	C	17: 24,156,604	T370A	probably benign	Het
Amy1	A	G	3: 113,558,094	W449R	probably benign	Het
Aox3	A	T	1: 58,186,280	I1179F	probably benign	Het
Atp10a	C	A	7: 58,824,327	Q1121K	probably damaging	Het
Btaf1	C	T	19: 36,951,148	A123V	probably benign	Het
Car6	T	C	4: 150,198,141	K16E	probably benign	Het
Cgnl1	C	T	9: 71,656,096	D779N	probably benign	Het
Cyp2a4	G	A	7: 26,308,537	R123Q	possibly damaging	Het
D430041D05Rik	C	T	2: 104,156,816	R1895Q	probably damaging	Het
D5Ertd579e	T	A	5: 36,616,206	T282S	probably benign	Het
Dsel	T	C	1: 111,859,962	T948A	probably benign	Het
Ednrb	A	T	14: 103,843,100	I126N	probably damaging	Het
Egln1	A	G	8: 124,948,306	M250T	probably benign	Het
Epb41l3	A	T	17: 69,253,468	I337L	possibly damaging	Het
Epg5	T	C	18: 77,948,745	I219T	probably benign	Het
Gm13030	T	C	4: 138,873,419		probably benign	Het
Gm1527	T	A	3: 28,926,661	C637S	probably benign	Het
Hist1h1a	A	G	13: 23,763,949	N78S	possibly damaging	Het
Insrr	T	C	3: 87,814,291	I1168T	possibly damaging	Het
Ireb2	T	C	9: 54,896,552	V509A	possibly damaging	Het
Kmt2c	T	C	5: 25,354,717	D981G	probably damaging	Het
Ktn1	A	G	14: 47,725,960	E1164G	probably damaging	Het
L3hypdh	A	T	12: 72,079,527	V213E	probably damaging	Het
Masp1	T	G	16: 23,491,959	D241A	probably damaging	Het
Mfsd13b	A	G	7: 120,991,824	I1V	probably null	Het
Muc5b	T	C	7: 141,869,754	V4531A	probably benign	Het
Myh2	A	T	11: 67,174,941		probably null	Het
Naip5	A	G	13: 100,221,533	L1065P	probably damaging	Het
Necab1	T	C	4: 15,140,219		probably benign	Het
Nemf	A	G	12: 69,353,786		probably benign	Het
Nfil3	A	T	13: 52,968,033	D278E	possibly damaging	Het
Ogdh	T	A	11: 6,349,393	M753K	probably benign	Het
Olfr11	A	T	13: 21,639,436	V29E	probably damaging	Het
Olfr1297	C	T	2: 111,621,739	V112M	probably benign	Het
Olfr273	T	C	4: 52,855,568	Y315C	probably benign	Het
Olfr561	T	C	7: 102,775,243	F240L	probably benign	Het
Olfr901	T	A	9: 38,431,082	S267T	probably benign	Het
Pkd2	A	G	5: 104,477,123	K262E	probably benign	Het
Plce1	C	T	19: 38,727,013		probably benign	Het
Ppm1f	T	A	16: 16,923,880	M406K	possibly damaging	Het
Ptgs1	C	T	2: 36,242,847	Q286*	probably null	Het
Scube2	T	C	7: 109,808,505	T743A	possibly damaging	Het
Tipin	T	A	9: 64,290,376	L69*	probably null	Het
Tlk1	T	A	2: 70,738,445	K404N	probably damaging	Het
Tmem59	C	A	4: 107,178,774	L16I	probably damaging	Het
Utrn	T	C	10: 12,737,082	E426G	probably benign	Het
Xdh	A	T	17: 73,909,325	S709T	probably damaging	Het
Yjefn3	T	C	8: 69,889,487	N28D	probably damaging	Het
Zfp598	A	C	17: 24,679,667	D480A	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	102194987	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	102153971	missense	probably benign
IGL00798:Nup98	APN	7	102147204	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	102185918	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	102194711	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	102183486	missense	probably benign	0.37
IGL02490:Nup98	APN	7	102152366	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	102183545	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	102134964	missense	probably benign	0.00
R0040:Nup98	UTSW	7	102192034	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	102139652	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	102152428	missense	probably null
R0471:Nup98	UTSW	7	102138797	missense	probably benign	0.13
R0538:Nup98	UTSW	7	102186685	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	102152453	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	102134880	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	102134937	missense	probably benign	0.03
R1889:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R3423:Nup98	UTSW	7	102184877	missense	probably benign	0.03
R4361:Nup98	UTSW	7	102145714	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	102184831	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	102153196	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	102195800	missense	unknown
R4924:Nup98	UTSW	7	102134978	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5069:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5233:Nup98	UTSW	7	102195822	missense	unknown
R5779:Nup98	UTSW	7	102152361	missense	probably benign
R5922:Nup98	UTSW	7	102154017	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	102180429	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6343:Nup98	UTSW	7	102194750	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	102176315	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	102195016	missense	probably benign	0.03
R6577:Nup98	UTSW	7	102128846	splice site	probably null
R6900:Nup98	UTSW	7	102185962	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	102195041	missense	unknown
R7218:Nup98	UTSW	7	102191900	splice site	probably null
R7235:Nup98	UTSW	7	102125284	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	102134795	missense	probably benign
R7402:Nup98	UTSW	7	102134937	missense	probably benign	0.00
R7427:Nup98	UTSW	7	102135001	splice site	probably null
R7428:Nup98	UTSW	7	102135001	splice site	probably null
R7584:Nup98	UTSW	7	102176389	missense	probably benign	0.02
R7646:Nup98	UTSW	7	102154035	missense	probably benign	0.01
R7648:Nup98	UTSW	7	102124197	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	102153257	splice site	probably null
R7827:Nup98	UTSW	7	102124362	missense	probably benign	0.10
R7884:Nup98	UTSW	7	102176349	missense	probably benign	0.12
R7943:Nup98	UTSW	7	102194822	missense	probably benign	0.10
R8034:Nup98	UTSW	7	102145723	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	102186652	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	102134688	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	102194966	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9148:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9223:Nup98	UTSW	7	102184960	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9249:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9272:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9274:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9283:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9326:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9466:Nup98	UTSW	7	102169404	missense	probably benign	0.05
R9492:Nup98	UTSW	7	102129045	missense	probably benign	0.11
R9661:Nup98	UTSW	7	102132812	nonsense	probably null
T0970:Nup98	UTSW	7	102186752	unclassified	probably benign
X0054:Nup98	UTSW	7	102147208	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATCAGGCTACAGCTTACC -3'
(R):5'- TTACAAGCAGTTGTGAGCTGC -3'

Sequencing Primer
(F):5'- CAGGAGAATGATGTGTGGTAT -3'
(R):5'- CTTGAGTCCTCTGAAAGAGCAGTC -3'

Posted On

2014-09-17