Incidental Mutation 'R2080:Mfsd13b'
ID 229419
Institutional Source Beutler Lab
Gene Symbol Mfsd13b
Ensembl Gene ENSMUSG00000030877
Gene Name major facilitator superfamily domain containing 13B
Synonyms 4933427G17Rik
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 120581732-120614010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120591047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1 (I1V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033166] [ENSMUST00000138177] [ENSMUST00000149535] [ENSMUST00000216241]
AlphaFold A0A1L1SUA2
Predicted Effect probably damaging
Transcript: ENSMUST00000033166
AA Change: I263V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033166
Gene: ENSMUSG00000030877
AA Change: I263V

DomainStartEndE-ValueType
Pfam:MFS_2 9 439 5.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133939
AA Change: I1V
SMART Domains Protein: ENSMUSP00000121409
Gene: ENSMUSG00000030877
AA Change: I1V

DomainStartEndE-ValueType
transmembrane domain 48 67 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138177
Predicted Effect probably benign
Transcript: ENSMUST00000149535
SMART Domains Protein: ENSMUSP00000115341
Gene: ENSMUSG00000030877

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216241
AA Change: I263V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Mfsd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Mfsd13b APN 7 120,598,132 (GRCm39) missense probably damaging 1.00
IGL02985:Mfsd13b APN 7 120,599,395 (GRCm39) missense probably damaging 1.00
R1159:Mfsd13b UTSW 7 120,613,766 (GRCm39) missense probably damaging 0.98
R2041:Mfsd13b UTSW 7 120,591,139 (GRCm39) splice site probably benign
R4762:Mfsd13b UTSW 7 120,590,549 (GRCm39) missense probably damaging 1.00
R4885:Mfsd13b UTSW 7 120,590,711 (GRCm39) missense possibly damaging 0.80
R5082:Mfsd13b UTSW 7 120,598,201 (GRCm39) missense possibly damaging 0.94
R5282:Mfsd13b UTSW 7 120,591,056 (GRCm39) missense probably damaging 0.98
R5296:Mfsd13b UTSW 7 120,590,961 (GRCm39) missense probably damaging 1.00
R5411:Mfsd13b UTSW 7 120,599,346 (GRCm39) missense probably benign 0.03
R6563:Mfsd13b UTSW 7 120,594,690 (GRCm39) missense probably damaging 0.99
R7347:Mfsd13b UTSW 7 120,590,951 (GRCm39) missense probably benign 0.44
R8128:Mfsd13b UTSW 7 120,590,495 (GRCm39) missense possibly damaging 0.79
R8520:Mfsd13b UTSW 7 120,590,586 (GRCm39) missense probably benign
R9583:Mfsd13b UTSW 7 120,598,134 (GRCm39) missense possibly damaging 0.56
Z1176:Mfsd13b UTSW 7 120,590,900 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTGGCATGTTCAATGTGAGAC -3'
(R):5'- CTGGGCTCTGACTCTTAGTG -3'

Sequencing Primer
(F):5'- CATGTTCAATGTGAGACAGTTTGAG -3'
(R):5'- GCTCTGACTCTTAGTGTTTGTTAG -3'
Posted On 2014-09-17