Incidental Mutation 'R2080:Olfr901'
ID229424
Institutional Source Beutler Lab
Gene Symbol Olfr901
Ensembl Gene ENSMUSG00000052058
Gene Nameolfactory receptor 901
SynonymsGA_x6K02T2PVTD-32123032-32123967, MOR162-8
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38429455-38432682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38431082 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 267 (S267T)
Ref Sequence ENSEMBL: ENSMUSP00000150506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063716] [ENSMUST00000216502] [ENSMUST00000216644]
Predicted Effect probably benign
Transcript: ENSMUST00000063716
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066714
Gene: ENSMUSG00000052058
AA Change: S267T

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.2e-47 PFAM
Pfam:7tm_1 42 290 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216502
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216644
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Olfr901
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr901 APN 9 38430515 missense probably benign 0.20
IGL01875:Olfr901 APN 9 38430298 missense probably damaging 1.00
R0010:Olfr901 UTSW 9 38430920 missense possibly damaging 0.70
R1186:Olfr901 UTSW 9 38431101 missense possibly damaging 0.85
R1259:Olfr901 UTSW 9 38430873 missense probably damaging 0.99
R1273:Olfr901 UTSW 9 38430684 missense probably benign 0.05
R1475:Olfr901 UTSW 9 38430864 missense probably benign 0.30
R1530:Olfr901 UTSW 9 38430324 missense probably damaging 0.97
R1591:Olfr901 UTSW 9 38430411 missense probably damaging 1.00
R1750:Olfr901 UTSW 9 38430690 missense probably damaging 1.00
R1756:Olfr901 UTSW 9 38430995 missense probably benign
R3081:Olfr901 UTSW 9 38431056 missense possibly damaging 0.82
R4174:Olfr901 UTSW 9 38431020 missense probably damaging 0.97
R4299:Olfr901 UTSW 9 38430812 missense probably damaging 1.00
R4898:Olfr901 UTSW 9 38430815 missense probably benign 0.01
R5068:Olfr901 UTSW 9 38430464 missense probably damaging 1.00
R5695:Olfr901 UTSW 9 38431176 missense probably benign 0.01
R5973:Olfr901 UTSW 9 38430331 missense probably damaging 0.99
R6929:Olfr901 UTSW 9 38431148 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGTGTCAATGTGATAGGACCTAC -3'
(R):5'- AATCTGTGAACGGTTTTGCAC -3'

Sequencing Primer
(F):5'- TGTGATAGGACCTACATTGATCATC -3'
(R):5'- GAACGGTTTTGCACAATTAATTTTTG -3'
Posted On2014-09-17