Incidental Mutation 'R2080:Or8b42'
ID 229424
Institutional Source Beutler Lab
Gene Symbol Or8b42
Ensembl Gene ENSMUSG00000052058
Gene Name olfactory receptor family 8 subfamily B member 42
Synonyms Olfr901, GA_x6K02T2PVTD-32123032-32123967, MOR162-8
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38341580-38342515 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38342378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 267 (S267T)
Ref Sequence ENSEMBL: ENSMUSP00000150506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063716] [ENSMUST00000216502] [ENSMUST00000216644]
AlphaFold Q7TRD1
Predicted Effect probably benign
Transcript: ENSMUST00000063716
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066714
Gene: ENSMUSG00000052058
AA Change: S267T

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.2e-47 PFAM
Pfam:7tm_1 42 290 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216502
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216644
AA Change: S267T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Or8b42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Or8b42 APN 9 38,341,811 (GRCm39) missense probably benign 0.20
IGL01875:Or8b42 APN 9 38,341,594 (GRCm39) missense probably damaging 1.00
R0010:Or8b42 UTSW 9 38,342,216 (GRCm39) missense possibly damaging 0.70
R1186:Or8b42 UTSW 9 38,342,397 (GRCm39) missense possibly damaging 0.85
R1259:Or8b42 UTSW 9 38,342,169 (GRCm39) missense probably damaging 0.99
R1273:Or8b42 UTSW 9 38,341,980 (GRCm39) missense probably benign 0.05
R1475:Or8b42 UTSW 9 38,342,160 (GRCm39) missense probably benign 0.30
R1530:Or8b42 UTSW 9 38,341,620 (GRCm39) missense probably damaging 0.97
R1591:Or8b42 UTSW 9 38,341,707 (GRCm39) missense probably damaging 1.00
R1750:Or8b42 UTSW 9 38,341,986 (GRCm39) missense probably damaging 1.00
R1756:Or8b42 UTSW 9 38,342,291 (GRCm39) missense probably benign
R3081:Or8b42 UTSW 9 38,342,352 (GRCm39) missense possibly damaging 0.82
R4174:Or8b42 UTSW 9 38,342,316 (GRCm39) missense probably damaging 0.97
R4299:Or8b42 UTSW 9 38,342,108 (GRCm39) missense probably damaging 1.00
R4898:Or8b42 UTSW 9 38,342,111 (GRCm39) missense probably benign 0.01
R5068:Or8b42 UTSW 9 38,341,760 (GRCm39) missense probably damaging 1.00
R5695:Or8b42 UTSW 9 38,342,472 (GRCm39) missense probably benign 0.01
R5973:Or8b42 UTSW 9 38,341,627 (GRCm39) missense probably damaging 0.99
R6929:Or8b42 UTSW 9 38,342,444 (GRCm39) missense probably benign 0.22
R8265:Or8b42 UTSW 9 38,342,469 (GRCm39) missense probably damaging 0.99
R8321:Or8b42 UTSW 9 38,341,850 (GRCm39) missense probably damaging 0.97
R9425:Or8b42 UTSW 9 38,342,286 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGTGTCAATGTGATAGGACCTAC -3'
(R):5'- AATCTGTGAACGGTTTTGCAC -3'

Sequencing Primer
(F):5'- TGTGATAGGACCTACATTGATCATC -3'
(R):5'- GAACGGTTTTGCACAATTAATTTTTG -3'
Posted On 2014-09-17