Incidental Mutation 'R2080:Cgnl1'
ID 229427
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Name cingulin-like 1
Synonyms Jacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 71626509-71771602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71656096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 779 (D779N)
Ref Sequence ENSEMBL: ENSMUSP00000113917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072899
AA Change: D850N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: D850N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121322
AA Change: D779N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: D779N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122065
AA Change: D850N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: D850N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 splice site probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
R7975:Cgnl1 UTSW 9 71725322 missense probably benign 0.00
R7990:Cgnl1 UTSW 9 71725265 missense probably damaging 1.00
R8502:Cgnl1 UTSW 9 71630605 missense probably damaging 0.99
R8926:Cgnl1 UTSW 9 71725253 missense probably benign
R9010:Cgnl1 UTSW 9 71651349 missense probably damaging 1.00
R9106:Cgnl1 UTSW 9 71721591 splice site probably benign
R9189:Cgnl1 UTSW 9 71723565 nonsense probably null
R9395:Cgnl1 UTSW 9 71632672 missense probably benign 0.01
R9680:Cgnl1 UTSW 9 71655350 missense possibly damaging 0.65
R9694:Cgnl1 UTSW 9 71725521 missense probably benign 0.32
R9760:Cgnl1 UTSW 9 71645571 nonsense probably null
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCTATGCTTGCAGTTTACC -3'
(R):5'- GAGGTTCCAGCAGCAACTTC -3'

Sequencing Primer
(F):5'- ACCTTGGCATCTTAACTAAATCCTG -3'
(R):5'- AGCAACTTCCTTCACGGG -3'
Posted On 2014-09-17