Incidental Mutation 'R2080:Cgnl1'
ID 229427
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Name cingulin-like 1
Synonyms 4933421H10Rik, Jacop, 9930020M10Rik
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 71533791-71678884 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71563378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 779 (D779N)
Ref Sequence ENSEMBL: ENSMUSP00000113917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072899
AA Change: D850N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: D850N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121322
AA Change: D779N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: D779N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122065
AA Change: D850N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: D850N

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71,563,338 (GRCm39) missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71,631,843 (GRCm39) missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71,539,144 (GRCm39) splice site probably benign
IGL01788:Cgnl1 APN 9 71,562,672 (GRCm39) missense probably benign
IGL01806:Cgnl1 APN 9 71,557,604 (GRCm39) missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71,631,849 (GRCm39) missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71,552,765 (GRCm39) splice site probably benign
IGL01939:Cgnl1 APN 9 71,632,286 (GRCm39) missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71,632,326 (GRCm39) missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71,633,135 (GRCm39) missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71,552,835 (GRCm39) missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71,632,639 (GRCm39) missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71,631,999 (GRCm39) small insertion probably benign
R0058:Cgnl1 UTSW 9 71,632,122 (GRCm39) missense probably damaging 0.99
R0058:Cgnl1 UTSW 9 71,548,679 (GRCm39) missense probably damaging 1.00
R0105:Cgnl1 UTSW 9 71,563,384 (GRCm39) missense probably benign
R0220:Cgnl1 UTSW 9 71,632,225 (GRCm39) missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71,628,939 (GRCm39) missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71,612,521 (GRCm39) missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71,558,535 (GRCm39) missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71,633,340 (GRCm39) missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71,624,713 (GRCm39) missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71,633,177 (GRCm39) missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71,628,994 (GRCm39) splice site probably benign
R1513:Cgnl1 UTSW 9 71,631,872 (GRCm39) missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71,633,097 (GRCm39) missense probably benign
R1599:Cgnl1 UTSW 9 71,548,709 (GRCm39) missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71,633,226 (GRCm39) missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71,632,817 (GRCm39) missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71,537,821 (GRCm39) missense probably damaging 1.00
R2085:Cgnl1 UTSW 9 71,538,160 (GRCm39) missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71,632,950 (GRCm39) nonsense probably null
R2402:Cgnl1 UTSW 9 71,632,461 (GRCm39) missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71,631,945 (GRCm39) missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71,612,575 (GRCm39) missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71,631,822 (GRCm39) missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71,537,806 (GRCm39) missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71,632,314 (GRCm39) missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71,624,683 (GRCm39) missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71,632,108 (GRCm39) small deletion probably benign
R5057:Cgnl1 UTSW 9 71,632,076 (GRCm39) missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71,539,936 (GRCm39) nonsense probably null
R5402:Cgnl1 UTSW 9 71,536,603 (GRCm39) missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71,537,957 (GRCm39) splice site probably null
R5770:Cgnl1 UTSW 9 71,552,769 (GRCm39) splice site probably null
R6911:Cgnl1 UTSW 9 71,563,497 (GRCm39) missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71,632,416 (GRCm39) missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71,633,015 (GRCm39) missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71,631,815 (GRCm39) missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71,539,927 (GRCm39) missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71,632,052 (GRCm39) missense probably benign
R7288:Cgnl1 UTSW 9 71,632,846 (GRCm39) missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71,633,165 (GRCm39) missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71,552,931 (GRCm39) missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71,539,040 (GRCm39) missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71,632,917 (GRCm39) missense probably damaging 1.00
R7975:Cgnl1 UTSW 9 71,632,604 (GRCm39) missense probably benign 0.00
R7990:Cgnl1 UTSW 9 71,632,547 (GRCm39) missense probably damaging 1.00
R8502:Cgnl1 UTSW 9 71,537,887 (GRCm39) missense probably damaging 0.99
R8926:Cgnl1 UTSW 9 71,632,535 (GRCm39) missense probably benign
R9010:Cgnl1 UTSW 9 71,558,631 (GRCm39) missense probably damaging 1.00
R9106:Cgnl1 UTSW 9 71,628,873 (GRCm39) splice site probably benign
R9189:Cgnl1 UTSW 9 71,630,847 (GRCm39) nonsense probably null
R9395:Cgnl1 UTSW 9 71,539,954 (GRCm39) missense probably benign 0.01
R9680:Cgnl1 UTSW 9 71,562,632 (GRCm39) missense possibly damaging 0.65
R9694:Cgnl1 UTSW 9 71,632,803 (GRCm39) missense probably benign 0.32
R9760:Cgnl1 UTSW 9 71,552,853 (GRCm39) nonsense probably null
RF015:Cgnl1 UTSW 9 71,631,997 (GRCm39) small insertion probably benign
RF042:Cgnl1 UTSW 9 71,631,997 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCTATGCTTGCAGTTTACC -3'
(R):5'- GAGGTTCCAGCAGCAACTTC -3'

Sequencing Primer
(F):5'- ACCTTGGCATCTTAACTAAATCCTG -3'
(R):5'- AGCAACTTCCTTCACGGG -3'
Posted On 2014-09-17