Incidental Mutation 'R2080:Utrn'
ID 229428
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Name utrophin
Synonyms G-utrophin, Dmdl, DRP
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 118
Status Validated
Chromosome 10
Chromosomal Location 12257932-12745109 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12612826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 426 (E426G)
Ref Sequence ENSEMBL: ENSMUSP00000151938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217899] [ENSMUST00000218635] [ENSMUST00000219584] [ENSMUST00000219660]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000076817
AA Change: E421G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: E421G

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217899
AA Change: E426G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218635
AA Change: E421G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000219584
AA Change: E421G

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219660
AA Change: E421G

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12,547,574 (GRCm39) missense probably damaging 1.00
IGL00469:Utrn APN 10 12,282,273 (GRCm39) missense probably damaging 1.00
IGL00518:Utrn APN 10 12,542,587 (GRCm39) splice site probably benign
IGL00560:Utrn APN 10 12,331,211 (GRCm39) nonsense probably null
IGL00589:Utrn APN 10 12,554,362 (GRCm39) missense possibly damaging 0.53
IGL00662:Utrn APN 10 12,540,705 (GRCm39) missense probably damaging 0.99
IGL00754:Utrn APN 10 12,539,236 (GRCm39) missense probably benign 0.05
IGL00772:Utrn APN 10 12,524,929 (GRCm39) missense probably benign
IGL00775:Utrn APN 10 12,620,974 (GRCm39) critical splice donor site probably null
IGL00782:Utrn APN 10 12,528,555 (GRCm39) missense probably benign 0.13
IGL00962:Utrn APN 10 12,357,078 (GRCm39) missense possibly damaging 0.80
IGL01584:Utrn APN 10 12,602,111 (GRCm39) missense probably benign 0.01
IGL01677:Utrn APN 10 12,619,901 (GRCm39) missense probably damaging 1.00
IGL01695:Utrn APN 10 12,621,086 (GRCm39) missense probably benign 0.00
IGL01743:Utrn APN 10 12,587,301 (GRCm39) missense possibly damaging 0.94
IGL01815:Utrn APN 10 12,528,460 (GRCm39) missense probably benign 0.00
IGL01901:Utrn APN 10 12,516,672 (GRCm39) missense probably damaging 1.00
IGL01982:Utrn APN 10 12,623,773 (GRCm39) missense probably damaging 1.00
IGL01983:Utrn APN 10 12,545,525 (GRCm39) missense probably benign 0.18
IGL02031:Utrn APN 10 12,610,948 (GRCm39) missense probably damaging 1.00
IGL02106:Utrn APN 10 12,289,717 (GRCm39) missense possibly damaging 0.92
IGL02134:Utrn APN 10 12,519,163 (GRCm39) missense probably damaging 0.99
IGL02209:Utrn APN 10 12,559,039 (GRCm39) missense probably damaging 0.97
IGL02217:Utrn APN 10 12,627,303 (GRCm39) missense probably damaging 1.00
IGL02250:Utrn APN 10 12,312,135 (GRCm39) missense probably damaging 1.00
IGL02307:Utrn APN 10 12,625,809 (GRCm39) nonsense probably null
IGL02386:Utrn APN 10 12,297,352 (GRCm39) missense possibly damaging 0.91
IGL02494:Utrn APN 10 12,585,798 (GRCm39) missense probably benign
IGL02631:Utrn APN 10 12,585,807 (GRCm39) missense probably benign 0.00
IGL02729:Utrn APN 10 12,596,554 (GRCm39) unclassified probably benign
IGL02736:Utrn APN 10 12,297,384 (GRCm39) missense probably damaging 1.00
IGL02832:Utrn APN 10 12,613,937 (GRCm39) missense possibly damaging 0.82
IGL02926:Utrn APN 10 12,566,504 (GRCm39) missense probably damaging 0.96
IGL03184:Utrn APN 10 12,585,910 (GRCm39) missense probably benign 0.04
IGL03194:Utrn APN 10 12,282,173 (GRCm39) splice site probably benign
IGL03346:Utrn APN 10 12,401,096 (GRCm39) missense probably benign 0.22
retiring UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
shrinking_violet UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
Wallflower UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
FR4548:Utrn UTSW 10 12,509,685 (GRCm39) critical splice donor site probably benign
I2288:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12,542,448 (GRCm39) missense probably benign 0.06
R0022:Utrn UTSW 10 12,585,700 (GRCm39) splice site probably benign
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0091:Utrn UTSW 10 12,610,948 (GRCm39) missense probably damaging 1.00
R0112:Utrn UTSW 10 12,562,209 (GRCm39) nonsense probably null
R0126:Utrn UTSW 10 12,587,219 (GRCm39) missense probably benign 0.02
R0184:Utrn UTSW 10 12,543,362 (GRCm39) missense probably benign
R0219:Utrn UTSW 10 12,560,195 (GRCm39) missense probably damaging 1.00
R0369:Utrn UTSW 10 12,509,766 (GRCm39) missense probably benign 0.37
R0390:Utrn UTSW 10 12,585,804 (GRCm39) missense probably benign 0.05
R0391:Utrn UTSW 10 12,401,077 (GRCm39) splice site probably benign
R0408:Utrn UTSW 10 12,259,934 (GRCm39) makesense probably null
R0409:Utrn UTSW 10 12,519,345 (GRCm39) missense probably benign 0.01
R0441:Utrn UTSW 10 12,564,038 (GRCm39) missense probably null 0.88
R0504:Utrn UTSW 10 12,278,639 (GRCm39) missense probably benign 0.02
R0730:Utrn UTSW 10 12,573,902 (GRCm39) splice site probably benign
R1078:Utrn UTSW 10 12,331,310 (GRCm39) critical splice acceptor site probably null
R1171:Utrn UTSW 10 12,357,052 (GRCm39) missense probably damaging 0.99
R1191:Utrn UTSW 10 12,509,777 (GRCm39) missense probably benign 0.02
R1203:Utrn UTSW 10 12,362,281 (GRCm39) missense probably damaging 1.00
R1401:Utrn UTSW 10 12,524,897 (GRCm39) missense probably benign
R1418:Utrn UTSW 10 12,589,094 (GRCm39) missense probably benign
R1439:Utrn UTSW 10 12,619,793 (GRCm39) missense possibly damaging 0.79
R1441:Utrn UTSW 10 12,559,039 (GRCm39) missense probably damaging 0.97
R1445:Utrn UTSW 10 12,554,318 (GRCm39) splice site probably benign
R1509:Utrn UTSW 10 12,331,185 (GRCm39) missense possibly damaging 0.91
R1546:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1585:Utrn UTSW 10 12,312,029 (GRCm39) missense possibly damaging 0.62
R1621:Utrn UTSW 10 12,589,027 (GRCm39) missense probably benign 0.24
R1637:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1703:Utrn UTSW 10 12,603,473 (GRCm39) splice site probably benign
R1725:Utrn UTSW 10 12,539,263 (GRCm39) missense probably damaging 0.99
R1735:Utrn UTSW 10 12,585,882 (GRCm39) missense probably benign
R1770:Utrn UTSW 10 12,351,040 (GRCm39) missense probably damaging 0.98
R1778:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1783:Utrn UTSW 10 12,339,083 (GRCm39) missense probably damaging 1.00
R1818:Utrn UTSW 10 12,585,708 (GRCm39) critical splice donor site probably null
R1829:Utrn UTSW 10 12,351,018 (GRCm39) missense probably damaging 1.00
R1919:Utrn UTSW 10 12,331,224 (GRCm39) missense probably benign 0.15
R1964:Utrn UTSW 10 12,560,181 (GRCm39) missense probably damaging 1.00
R2092:Utrn UTSW 10 12,554,442 (GRCm39) missense probably benign 0.12
R2107:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2108:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2760:Utrn UTSW 10 12,566,622 (GRCm39) missense probably damaging 1.00
R2884:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2885:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2886:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2903:Utrn UTSW 10 12,519,172 (GRCm39) missense probably damaging 1.00
R2944:Utrn UTSW 10 12,519,163 (GRCm39) missense probably damaging 1.00
R2945:Utrn UTSW 10 12,362,135 (GRCm39) missense possibly damaging 0.50
R3438:Utrn UTSW 10 12,357,062 (GRCm39) missense probably damaging 0.98
R3683:Utrn UTSW 10 12,542,579 (GRCm39) missense probably benign 0.10
R3735:Utrn UTSW 10 12,354,228 (GRCm39) missense probably damaging 1.00
R3907:Utrn UTSW 10 12,585,926 (GRCm39) splice site probably benign
R3923:Utrn UTSW 10 12,615,223 (GRCm39) missense probably benign 0.23
R3925:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3926:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3938:Utrn UTSW 10 12,625,774 (GRCm39) critical splice donor site probably null
R3941:Utrn UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
R3958:Utrn UTSW 10 12,625,852 (GRCm39) missense probably damaging 1.00
R4091:Utrn UTSW 10 12,585,915 (GRCm39) missense probably benign 0.10
R4454:Utrn UTSW 10 12,603,584 (GRCm39) missense possibly damaging 0.81
R4585:Utrn UTSW 10 12,564,050 (GRCm39) missense probably benign 0.01
R4667:Utrn UTSW 10 12,573,797 (GRCm39) missense probably benign 0.22
R4684:Utrn UTSW 10 12,620,984 (GRCm39) missense probably damaging 1.00
R4782:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4785:Utrn UTSW 10 12,530,489 (GRCm39) missense probably benign 0.39
R4799:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4829:Utrn UTSW 10 12,539,205 (GRCm39) missense probably benign 0.00
R4878:Utrn UTSW 10 12,603,502 (GRCm39) missense probably damaging 1.00
R4955:Utrn UTSW 10 12,737,311 (GRCm39) critical splice donor site probably null
R4967:Utrn UTSW 10 12,331,164 (GRCm39) missense probably damaging 0.99
R5071:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5072:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5186:Utrn UTSW 10 12,604,521 (GRCm39) missense probably damaging 1.00
R5213:Utrn UTSW 10 12,512,504 (GRCm39) missense probably damaging 1.00
R5296:Utrn UTSW 10 12,277,099 (GRCm39) missense probably damaging 1.00
R5309:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5312:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5399:Utrn UTSW 10 12,516,727 (GRCm39) missense probably damaging 1.00
R5407:Utrn UTSW 10 12,556,369 (GRCm39) missense probably damaging 1.00
R5411:Utrn UTSW 10 12,524,929 (GRCm39) missense probably benign
R5428:Utrn UTSW 10 12,569,175 (GRCm39) missense probably benign 0.09
R5595:Utrn UTSW 10 12,558,062 (GRCm39) missense possibly damaging 0.89
R5602:Utrn UTSW 10 12,625,839 (GRCm39) missense probably damaging 1.00
R5608:Utrn UTSW 10 12,547,581 (GRCm39) missense probably benign 0.00
R5678:Utrn UTSW 10 12,317,762 (GRCm39) missense probably damaging 1.00
R5726:Utrn UTSW 10 12,545,550 (GRCm39) missense probably benign
R5804:Utrn UTSW 10 12,297,369 (GRCm39) missense probably damaging 1.00
R5916:Utrn UTSW 10 12,540,795 (GRCm39) missense probably damaging 0.97
R5941:Utrn UTSW 10 12,362,227 (GRCm39) missense probably damaging 1.00
R6014:Utrn UTSW 10 12,566,620 (GRCm39) missense probably benign 0.01
R6015:Utrn UTSW 10 12,354,168 (GRCm39) missense possibly damaging 0.85
R6028:Utrn UTSW 10 12,530,460 (GRCm39) missense probably benign 0.00
R6158:Utrn UTSW 10 12,566,566 (GRCm39) missense probably benign 0.04
R6181:Utrn UTSW 10 12,615,200 (GRCm39) missense probably damaging 1.00
R6300:Utrn UTSW 10 12,377,220 (GRCm39) missense probably benign 0.35
R6367:Utrn UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
R6377:Utrn UTSW 10 12,619,827 (GRCm39) missense probably damaging 1.00
R6434:Utrn UTSW 10 12,401,171 (GRCm39) missense probably damaging 1.00
R6498:Utrn UTSW 10 12,317,837 (GRCm39) missense probably benign
R6579:Utrn UTSW 10 12,623,750 (GRCm39) missense probably benign 0.05
R6704:Utrn UTSW 10 12,621,035 (GRCm39) missense probably damaging 0.99
R6736:Utrn UTSW 10 12,497,047 (GRCm39) missense probably benign 0.09
R6755:Utrn UTSW 10 12,574,831 (GRCm39) missense probably benign 0.00
R6793:Utrn UTSW 10 12,574,844 (GRCm39) missense possibly damaging 0.69
R6793:Utrn UTSW 10 12,516,669 (GRCm39) critical splice donor site probably null
R6835:Utrn UTSW 10 12,603,508 (GRCm39) missense probably damaging 1.00
R6919:Utrn UTSW 10 12,569,214 (GRCm39) nonsense probably null
R6920:Utrn UTSW 10 12,626,214 (GRCm39) missense probably damaging 0.98
R7037:Utrn UTSW 10 12,702,514 (GRCm39) splice site probably null
R7038:Utrn UTSW 10 12,558,082 (GRCm39) missense probably damaging 1.00
R7055:Utrn UTSW 10 12,623,665 (GRCm39) missense probably benign 0.23
R7072:Utrn UTSW 10 12,340,957 (GRCm39) missense probably damaging 1.00
R7090:Utrn UTSW 10 12,560,260 (GRCm39) missense possibly damaging 0.58
R7211:Utrn UTSW 10 12,277,079 (GRCm39) missense possibly damaging 0.72
R7248:Utrn UTSW 10 12,604,562 (GRCm39) missense possibly damaging 0.51
R7305:Utrn UTSW 10 12,261,280 (GRCm39) missense probably benign
R7334:Utrn UTSW 10 12,603,753 (GRCm39) splice site probably null
R7348:Utrn UTSW 10 12,623,762 (GRCm39) missense probably damaging 1.00
R7375:Utrn UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
R7436:Utrn UTSW 10 12,315,535 (GRCm39) missense possibly damaging 0.72
R7476:Utrn UTSW 10 12,516,695 (GRCm39) missense probably benign
R7514:Utrn UTSW 10 12,573,833 (GRCm39) missense probably benign 0.00
R7527:Utrn UTSW 10 12,277,126 (GRCm39) missense possibly damaging 0.81
R7735:Utrn UTSW 10 12,619,787 (GRCm39) critical splice donor site probably null
R7748:Utrn UTSW 10 12,490,252 (GRCm39) missense probably benign 0.01
R7778:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7824:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7826:Utrn UTSW 10 12,277,050 (GRCm39) splice site probably null
R7872:Utrn UTSW 10 12,573,873 (GRCm39) missense probably benign
R7915:Utrn UTSW 10 12,340,956 (GRCm39) missense probably damaging 1.00
R7922:Utrn UTSW 10 12,543,271 (GRCm39) missense possibly damaging 0.68
R8081:Utrn UTSW 10 12,423,803 (GRCm39) start gained probably benign
R8132:Utrn UTSW 10 12,558,154 (GRCm39) missense probably damaging 0.99
R8167:Utrn UTSW 10 12,547,558 (GRCm39) nonsense probably null
R8186:Utrn UTSW 10 12,573,867 (GRCm39) missense probably benign
R8331:Utrn UTSW 10 12,490,363 (GRCm39) missense probably benign 0.00
R8352:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8408:Utrn UTSW 10 12,545,887 (GRCm39) missense possibly damaging 0.69
R8452:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8478:Utrn UTSW 10 12,524,892 (GRCm39) missense probably benign
R8489:Utrn UTSW 10 12,587,190 (GRCm39) missense probably benign 0.05
R8516:Utrn UTSW 10 12,362,254 (GRCm39) missense probably damaging 0.99
R8520:Utrn UTSW 10 12,545,930 (GRCm39) nonsense probably null
R8550:Utrn UTSW 10 12,689,329 (GRCm39) intron probably benign
R8856:Utrn UTSW 10 12,543,351 (GRCm39) missense probably benign
R8881:Utrn UTSW 10 12,423,737 (GRCm39) missense possibly damaging 0.46
R9180:Utrn UTSW 10 12,545,463 (GRCm39) missense probably damaging 1.00
R9186:Utrn UTSW 10 12,490,318 (GRCm39) missense probably benign
R9216:Utrn UTSW 10 12,689,229 (GRCm39) missense probably benign 0.19
R9251:Utrn UTSW 10 12,512,531 (GRCm39) missense probably benign 0.01
R9273:Utrn UTSW 10 12,509,707 (GRCm39) missense probably damaging 0.97
R9307:Utrn UTSW 10 12,554,475 (GRCm39) missense probably benign 0.02
R9344:Utrn UTSW 10 12,560,275 (GRCm39) missense probably benign 0.17
R9419:Utrn UTSW 10 12,564,125 (GRCm39) missense probably damaging 1.00
R9435:Utrn UTSW 10 12,519,173 (GRCm39) missense probably damaging 1.00
R9623:Utrn UTSW 10 12,282,225 (GRCm39) missense probably damaging 1.00
R9650:Utrn UTSW 10 12,613,929 (GRCm39) missense probably benign 0.00
R9653:Utrn UTSW 10 12,539,189 (GRCm39) missense probably benign 0.41
R9653:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
R9672:Utrn UTSW 10 12,603,613 (GRCm39) missense possibly damaging 0.68
R9678:Utrn UTSW 10 12,615,159 (GRCm39) missense probably benign 0.00
R9741:Utrn UTSW 10 12,702,564 (GRCm39) missense probably benign
R9765:Utrn UTSW 10 12,610,921 (GRCm39) missense probably damaging 0.99
R9799:Utrn UTSW 10 12,585,736 (GRCm39) missense probably benign 0.01
RF009:Utrn UTSW 10 12,509,689 (GRCm39) nonsense probably null
V1662:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
X0018:Utrn UTSW 10 12,610,942 (GRCm39) missense probably damaging 1.00
Z1176:Utrn UTSW 10 12,564,173 (GRCm39) critical splice acceptor site probably null
Z1176:Utrn UTSW 10 12,558,104 (GRCm39) nonsense probably null
Z1177:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
Z1177:Utrn UTSW 10 12,401,150 (GRCm39) nonsense probably null
Z1186:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1189:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1191:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1192:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAAGTAGCCCAACTCC -3'
(R):5'- GAATCAAATCAGAGCTTTCCCC -3'

Sequencing Primer
(F):5'- GGGTCAGCTCAGCACTCTTC -3'
(R):5'- AAATCAGAGCTTTCCCCCTTAG -3'
Posted On 2014-09-17