Incidental Mutation 'R2080:Nfil3'
ID 229435
Institutional Source Beutler Lab
Gene Symbol Nfil3
Ensembl Gene ENSMUSG00000056749
Gene Name nuclear factor, interleukin 3, regulated
Synonyms E4BP4
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 52967209-52981073 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52968033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 278 (D278E)
Ref Sequence ENSEMBL: ENSMUSP00000065363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071065]
AlphaFold O08750
Predicted Effect possibly damaging
Transcript: ENSMUST00000071065
AA Change: D278E

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065363
Gene: ENSMUSG00000056749
AA Change: D278E

DomainStartEndE-ValueType
BRLZ 71 135 2.84e-5 SMART
low complexity region 182 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083837
Meta Mutation Damage Score 0.7456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcriptional regulator that binds as a homodimer to activating transcription factor (ATF) sites in many cellular and viral promoters. The encoded protein represses Per1 and Per2 expression and therefore plays a role in the regulation of circadian rhythm. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased NK cell differentiation, numbers, and activity. Mice homozygous for a different knock-out allele exhibit reduced class switching and IgE production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Nfil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Nfil3 APN 13 52967574 missense probably damaging 1.00
IGL01017:Nfil3 APN 13 52968019 missense probably damaging 1.00
IGL02158:Nfil3 APN 13 52968152 missense probably damaging 0.99
luna UTSW 13 52968676 missense probably damaging 1.00
R0140:Nfil3 UTSW 13 52967645 nonsense probably null
R4235:Nfil3 UTSW 13 52968799 missense probably benign 0.08
R4773:Nfil3 UTSW 13 52968014 missense probably damaging 0.99
R5002:Nfil3 UTSW 13 52968676 missense probably damaging 1.00
R5155:Nfil3 UTSW 13 52968580 missense probably damaging 1.00
R5309:Nfil3 UTSW 13 52967620 missense probably damaging 0.98
R5312:Nfil3 UTSW 13 52967620 missense probably damaging 0.98
R5404:Nfil3 UTSW 13 52968055 missense probably damaging 1.00
R5679:Nfil3 UTSW 13 52968491 missense possibly damaging 0.79
R5855:Nfil3 UTSW 13 52968710 missense probably benign 0.05
R6855:Nfil3 UTSW 13 52968605 nonsense probably null
R7836:Nfil3 UTSW 13 52967932 missense possibly damaging 0.56
R7870:Nfil3 UTSW 13 52968413 missense probably damaging 0.99
R8394:Nfil3 UTSW 13 52967813 missense probably benign 0.09
R8713:Nfil3 UTSW 13 52968011 missense possibly damaging 0.94
R9008:Nfil3 UTSW 13 52967573 missense probably damaging 1.00
R9143:Nfil3 UTSW 13 52967756 missense probably benign
R9733:Nfil3 UTSW 13 52967555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCAAACTCGCTGTCCAAAG -3'
(R):5'- AGTTCCCTGTGATCAAGCAG -3'

Sequencing Primer
(F):5'- AAAGCCTCCACTTTGACCTG -3'
(R):5'- TGTGATCAAGCAGGAGCCC -3'
Posted On 2014-09-17