Incidental Mutation 'R2080:Naip5'
ID 229436
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Naip-rs3, Lgn1
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 100348247-100382831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100358041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1065 (L1065P)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably damaging
Transcript: ENSMUST00000049789
AA Change: L1065P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: L1065P

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
Ktn1 A G 14: 47,963,417 (GRCm39) E1164G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100,382,683 (GRCm39) nonsense probably null
IGL00493:Naip5 APN 13 100,367,279 (GRCm39) missense probably damaging 0.96
IGL01294:Naip5 APN 13 100,353,588 (GRCm39) missense probably damaging 0.99
IGL01405:Naip5 APN 13 100,358,453 (GRCm39) missense probably benign 0.11
IGL01568:Naip5 APN 13 100,353,609 (GRCm39) missense probably benign 0.26
IGL01804:Naip5 APN 13 100,358,092 (GRCm39) missense probably damaging 1.00
IGL02012:Naip5 APN 13 100,359,847 (GRCm39) missense probably benign 0.01
IGL02183:Naip5 APN 13 100,358,150 (GRCm39) missense probably benign 0.41
IGL02449:Naip5 APN 13 100,358,683 (GRCm39) missense probably benign 0.34
IGL02815:Naip5 APN 13 100,359,239 (GRCm39) missense probably benign
IGL02992:Naip5 APN 13 100,359,536 (GRCm39) missense probably damaging 1.00
IGL03027:Naip5 APN 13 100,359,524 (GRCm39) missense probably benign 0.00
IGL03234:Naip5 APN 13 100,349,135 (GRCm39) missense probably damaging 1.00
inwood2 UTSW 13 100,359,522 (GRCm39) nonsense probably null
inwood3 UTSW 13 100,358,411 (GRCm39) nonsense probably null
Nuchal UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100,356,268 (GRCm39) missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,359,622 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,351,158 (GRCm39) critical splice donor site probably null
R0462:Naip5 UTSW 13 100,358,240 (GRCm39) missense probably damaging 1.00
R0636:Naip5 UTSW 13 100,356,196 (GRCm39) missense probably benign
R0674:Naip5 UTSW 13 100,359,707 (GRCm39) missense probably benign 0.04
R0764:Naip5 UTSW 13 100,353,613 (GRCm39) missense probably benign 0.03
R0837:Naip5 UTSW 13 100,367,251 (GRCm39) missense probably benign
R1179:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R1302:Naip5 UTSW 13 100,358,099 (GRCm39) missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100,356,225 (GRCm39) missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100,358,714 (GRCm39) missense probably benign
R1638:Naip5 UTSW 13 100,349,177 (GRCm39) missense probably damaging 1.00
R1651:Naip5 UTSW 13 100,358,419 (GRCm39) missense probably benign 0.41
R1707:Naip5 UTSW 13 100,379,363 (GRCm39) missense probably damaging 1.00
R1835:Naip5 UTSW 13 100,359,726 (GRCm39) nonsense probably null
R1836:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.18
R1972:Naip5 UTSW 13 100,349,278 (GRCm39) missense probably damaging 0.98
R2333:Naip5 UTSW 13 100,359,679 (GRCm39) missense probably damaging 1.00
R2348:Naip5 UTSW 13 100,356,246 (GRCm39) missense probably benign 0.01
R3055:Naip5 UTSW 13 100,358,386 (GRCm39) missense probably benign 0.23
R3401:Naip5 UTSW 13 100,358,411 (GRCm39) nonsense probably null
R3723:Naip5 UTSW 13 100,359,522 (GRCm39) nonsense probably null
R3775:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R3775:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4074:Naip5 UTSW 13 100,382,572 (GRCm39) missense probably damaging 1.00
R4082:Naip5 UTSW 13 100,382,338 (GRCm39) missense probably damaging 1.00
R4105:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R4227:Naip5 UTSW 13 100,349,276 (GRCm39) missense probably damaging 0.99
R4639:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4640:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4641:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4644:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4645:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4700:Naip5 UTSW 13 100,359,922 (GRCm39) missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100,358,378 (GRCm39) missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100,358,639 (GRCm39) missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100,356,189 (GRCm39) missense probably benign 0.32
R4816:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.01
R4816:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R4869:Naip5 UTSW 13 100,381,639 (GRCm39) missense probably damaging 1.00
R5162:Naip5 UTSW 13 100,359,914 (GRCm39) missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100,382,170 (GRCm39) missense probably benign 0.08
R5411:Naip5 UTSW 13 100,382,254 (GRCm39) missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100,367,170 (GRCm39) splice site probably null
R5760:Naip5 UTSW 13 100,379,346 (GRCm39) missense probably damaging 1.00
R5916:Naip5 UTSW 13 100,359,209 (GRCm39) missense probably benign 0.02
R6302:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100,359,913 (GRCm39) missense probably benign 0.01
R6474:Naip5 UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100,358,102 (GRCm39) missense probably benign
R6544:Naip5 UTSW 13 100,359,652 (GRCm39) missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100,382,437 (GRCm39) missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100,359,922 (GRCm39) missense probably damaging 0.99
R7052:Naip5 UTSW 13 100,358,855 (GRCm39) missense probably benign 0.01
R7138:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7141:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7375:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7375:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7401:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7447:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7466:Naip5 UTSW 13 100,358,494 (GRCm39) nonsense probably null
R7491:Naip5 UTSW 13 100,353,579 (GRCm39) missense probably benign 0.18
R7559:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7559:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7562:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7562:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7588:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7588:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7589:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7590:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7742:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7886:Naip5 UTSW 13 100,382,689 (GRCm39) missense probably benign 0.28
R7996:Naip5 UTSW 13 100,358,164 (GRCm39) missense probably damaging 1.00
R8026:Naip5 UTSW 13 100,382,406 (GRCm39) missense probably damaging 1.00
R8046:Naip5 UTSW 13 100,358,741 (GRCm39) missense probably benign
R8319:Naip5 UTSW 13 100,358,167 (GRCm39) missense probably benign 0.12
R8471:Naip5 UTSW 13 100,358,153 (GRCm39) missense probably damaging 0.99
R8480:Naip5 UTSW 13 100,358,743 (GRCm39) missense probably damaging 1.00
R8496:Naip5 UTSW 13 100,349,247 (GRCm39) missense probably benign 0.00
R8500:Naip5 UTSW 13 100,359,220 (GRCm39) missense probably damaging 0.98
R8712:Naip5 UTSW 13 100,359,604 (GRCm39) missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8781:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8788:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8817:Naip5 UTSW 13 100,349,207 (GRCm39) missense probably benign 0.01
R8833:Naip5 UTSW 13 100,359,442 (GRCm39) missense probably damaging 0.97
R8835:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8958:Naip5 UTSW 13 100,354,117 (GRCm39) nonsense probably null
R9031:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9032:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9074:Naip5 UTSW 13 100,358,264 (GRCm39) missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100,366,127 (GRCm39) missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100,359,008 (GRCm39) missense probably damaging 1.00
R9223:Naip5 UTSW 13 100,364,184 (GRCm39) missense probably benign 0.05
R9358:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9389:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9403:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9518:Naip5 UTSW 13 100,358,367 (GRCm39) missense probably benign
R9568:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9568:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9569:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9569:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9570:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9572:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9581:Naip5 UTSW 13 100,351,194 (GRCm39) missense probably benign 0.11
R9627:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9725:Naip5 UTSW 13 100,358,784 (GRCm39) missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9764:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9765:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCTACCAAGACACATTCATGG -3'
(R):5'- CATGCAAGATCCCCAAGCTG -3'

Sequencing Primer
(F):5'- CAAGACACATTCATGGCCTTGTG -3'
(R):5'- TCCCCAAGCTGGAAGTTCAAGTG -3'
Posted On 2014-09-17